https://kimkeunwook.com kimkeunwook Mon, 30 Mar 2026 23:14:33 +0000 https://kimkeunwook.com en https://kimkeunwook.com/Home Mon, 02 Nov 2020 13:48:07 +0000 kimkeunwook https://kimkeunwook.com/Home https://kimkeunwook.com/Memorscope Thu, 29 Feb 2024 19:09:46 +0000 kimkeunwook https://kimkeunwook.com/Memorscope Memorscope Collective Memory Sharing Device, 2024Industrial design, Interaction design, HCI Research, Creative direction Presented at : MIT News, MIT Morningside Academy of Design, NeurIPS Imagine you’ve gone on a trip with your family and friends. What if you could revisit those precious memories without sifting through hundreds of photos dumped into a shared album that you never actually look back at? <img width="6000" height="3376" width_o="6000" height_o="3376" data-src="https://freight.cargo.site/t/original/i/6337062a0d1021e2d8a1c464d4da32093cd31f296f9da01a3b6ae62f71d96da6/DSC04455.JPG" data-mid="226743719" border="0" src="https://freight.cargo.site/w/1000/i/6337062a0d1021e2d8a1c464d4da32093cd31f296f9da01a3b6ae62f71d96da6/DSC04455.JPG" /> &nbsp; Memorscope is a memory blending device that merges the deeply human experience of face-to-face interaction with advanced AI technologies to explore and create collective memories. &nbsp; &nbsp;Inspired by how we use microscopes and telescopes to examine and uncover hidden details, Memorscope allows two users to “look into” each other’s faces, using this intimate interaction as a gateway to their shared memories. &nbsp; Through this process, the device leverages AI models like those from OpenAI and Midjourney, which introduce different aesthetic and emotional interpretations, resulting in a dynamic and evolving collective memory space. <img width="5712" height="4284" width_o="5712" height_o="4284" data-src="https://freight.cargo.site/t/original/i/c284775e90faff872bc8c504797d211ebcd4578309971b66cc84e8faa7a7d599/Participants1.jpg" data-mid="226743724" border="0" src="https://freight.cargo.site/w/1000/i/c284775e90faff872bc8c504797d211ebcd4578309971b66cc84e8faa7a7d599/Participants1.jpg" />*Thanks to Udayan and Sam for being the perfect models! &nbsp; This space transcends the limitations of traditional shared albums, offering a fluid, interactive environment where memories are not just static snapshots but living, evolving narratives shaped by the ongoing relationship between users.&nbsp; Memorscope, therefore, stands at the intersection of technology and art, redefining how we perceive, share, and engage with our memories, making the act of remembering a collaborative and emotionally resonant experience. Device Final Photos <img width="6000" height="3376" width_o="6000" height_o="3376" data-src="https://freight.cargo.site/t/original/i/7e439e1927a6c001b13134b80ba32aafc92c52d24bd563e5c5a7767fda8885dd/DSC04480.JPG" data-mid="226741036" border="0" src="https://freight.cargo.site/w/1000/i/7e439e1927a6c001b13134b80ba32aafc92c52d24bd563e5c5a7767fda8885dd/DSC04480.JPG" /> <img width="768" height="1024" width_o="768" height_o="1024" data-src="https://freight.cargo.site/t/original/i/8888a71f21f9781ae04d8c1b9d7239400244a45e391d6a908df47c045409f45c/thumnail_memorscope.png" data-mid="226753599" border="0" src="https://freight.cargo.site/w/768/i/8888a71f21f9781ae04d8c1b9d7239400244a45e391d6a908df47c045409f45c/thumnail_memorscope.png" /> <img width="1024" height="768" width_o="1024" height_o="768" data-src="https://freight.cargo.site/t/original/i/0e8467dbee97396e873c00640a5ee464fde648a788244103130200c128f2c000/hold_memorscope.png" data-mid="226754361" border="0" src="https://freight.cargo.site/w/1000/i/0e8467dbee97396e873c00640a5ee464fde648a788244103130200c128f2c000/hold_memorscope.png" /> How it works Collective Memory Space&nbsp; <img width="3198" height="1798" width_o="3198" height_o="1798" data-src="https://freight.cargo.site/t/original/i/f6ad6b30dcb5f9cd73341f062de766dd4dca12e1193d8a0f4f6479f41c440d79/Collective-Memory-Diagram.png" data-mid="226750940" border="0" src="https://freight.cargo.site/w/1000/i/f6ad6b30dcb5f9cd73341f062de766dd4dca12e1193d8a0f4f6479f41c440d79/Collective-Memory-Diagram.png" /> Workflow of Memorscope <img width="6400" height="3600" width_o="6400" height_o="3600" data-src="https://freight.cargo.site/t/original/i/bbf7ecb95eba2c7eee185a07207ee2b0540b0a7cf62d64f8768ba53fcfef3e50/Memoroscope_How-it-works.png" data-mid="226750821" border="0" src="https://freight.cargo.site/w/1000/i/bbf7ecb95eba2c7eee185a07207ee2b0540b0a7cf62d64f8768ba53fcfef3e50/Memoroscope_How-it-works.png" /> Wearables <img width="6400" height="3600" width_o="6400" height_o="3600" data-src="https://freight.cargo.site/t/original/i/340a6e137fcd0f273a481eb0d07e3a6e44a0b30c5d41ea8a264ccc2d2a0c40bf/Memorscope_Wearables.png" data-mid="226756453" border="0" src="https://freight.cargo.site/w/1000/i/340a6e137fcd0f273a481eb0d07e3a6e44a0b30c5d41ea8a264ccc2d2a0c40bf/Memorscope_Wearables.png" /> Motive <img width="3198" height="1784" width_o="3198" height_o="1784" data-src="https://freight.cargo.site/t/original/i/c3d9114730f55c64639d0a83d41c32c0f487f5b267177cd1b59960d6094b5d99/Screenshot-2025-02-18-at-3.50.38AM.png" data-mid="226756144" border="0" src="https://freight.cargo.site/w/1000/i/c3d9114730f55c64639d0a83d41c32c0f487f5b267177cd1b59960d6094b5d99/Screenshot-2025-02-18-at-3.50.38AM.png" /> Demo Exhibition : Orbit - Aug.2024, Seoul, South Korea They look And they talk about each other’s memory Demo : NeurIPS Creative AI -Dec.2024, Vencuver, Canada Process Sketches <img width="2370" height="1756" width_o="2370" height_o="1756" data-src="https://freight.cargo.site/t/original/i/b36bd5f492c7ba33173922c08246621e9775d3e066c94b3ded4b88891cdaad4f/Screenshot-2025-02-18-at-4.55.55AM.png" data-mid="226755688" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/b36bd5f492c7ba33173922c08246621e9775d3e066c94b3ded4b88891cdaad4f/Screenshot-2025-02-18-at-4.55.55AM.png" /> <img width="2358" height="1770" width_o="2358" height_o="1770" data-src="https://freight.cargo.site/t/original/i/6fc39adedb616e9bbc4b8775d86cdff0e215bfe837ad9c66ff7800f4825609e9/Screenshot-2025-02-18-at-4.56.54AM.png" data-mid="226755884" border="0" src="https://freight.cargo.site/w/1000/i/6fc39adedb616e9bbc4b8775d86cdff0e215bfe837ad9c66ff7800f4825609e9/Screenshot-2025-02-18-at-4.56.54AM.png" /> Inspiration images ( from Blade Runner2049, Harry Potter, Inside Out ) <img width="1820" height="740" width_o="1820" height_o="740" data-src="https://freight.cargo.site/t/original/i/e655d9741aeb5a9be8c1ba06bcb32d95f22b75773d1dc66ff101e0020ca6e6f6/Screenshot-2025-02-18-at-5.03.34AM.png" data-mid="226756275" border="0" src="https://freight.cargo.site/w/1000/i/e655d9741aeb5a9be8c1ba06bcb32d95f22b75773d1dc66ff101e0020ca6e6f6/Screenshot-2025-02-18-at-5.03.34AM.png" /> <img width="3196" height="1744" width_o="3196" height_o="1744" data-src="https://freight.cargo.site/t/original/i/17ca6e0f55a2db4edd2c14498425ffbfdd07863737412fff0376af0a5b4ec0fb/Screenshot-2025-02-18-at-5.02.51AM.png" data-mid="226756263" border="0" src="https://freight.cargo.site/w/1000/i/17ca6e0f55a2db4edd2c14498425ffbfdd07863737412fff0376af0a5b4ec0fb/Screenshot-2025-02-18-at-5.02.51AM.png" /> <img width="2862" height="1326" width_o="2862" height_o="1326" data-src="https://freight.cargo.site/t/original/i/8e3566f579c4f1b2c8adfbefaebb445453c5225f7754a4b455dd8baae4326df8/Screenshot-2025-02-18-at-5.07.33AM.png" data-mid="226756337" border="0" src="https://freight.cargo.site/w/1000/i/8e3566f579c4f1b2c8adfbefaebb445453c5225f7754a4b455dd8baae4326df8/Screenshot-2025-02-18-at-5.07.33AM.png" /> <img width="2644" height="1452" width_o="2644" height_o="1452" data-src="https://freight.cargo.site/t/original/i/793634b65314ad5805b7e9776d34147a378d33ad90ac0427d234991f44e89cff/Screenshot-2025-02-18-at-5.04.26AM.png" data-mid="226756286" border="0" src="https://freight.cargo.site/w/1000/i/793634b65314ad5805b7e9776d34147a378d33ad90ac0427d234991f44e89cff/Screenshot-2025-02-18-at-5.04.26AM.png" /> <img width="2736" height="1552" width_o="2736" height_o="1552" data-src="https://freight.cargo.site/t/original/i/ce6becf6de74ed9fdde26b45428cd1dc0b93ddf5c86fe0bea1e53d584f80e56f/Screenshot-2025-02-18-at-5.04.03AM.png" data-mid="226756284" border="0" src="https://freight.cargo.site/w/1000/i/ce6becf6de74ed9fdde26b45428cd1dc0b93ddf5c86fe0bea1e53d584f80e56f/Screenshot-2025-02-18-at-5.04.03AM.png" /> Reference Designs <img width="3172" height="1834" width_o="3172" height_o="1834" data-src="https://freight.cargo.site/t/original/i/d479ab0ccbced890933fe9a07e8d1d3d3cc377362f5389395e587879ce9d6482/Screenshot-2025-02-18-at-5.01.46AM.png" data-mid="226756243" border="0" src="https://freight.cargo.site/w/1000/i/d479ab0ccbced890933fe9a07e8d1d3d3cc377362f5389395e587879ce9d6482/Screenshot-2025-02-18-at-5.01.46AM.png" /> <img width="3258" height="1830" width_o="3258" height_o="1830" data-src="https://freight.cargo.site/t/original/i/82342fad87a1a53a565db93ad4685af4c6fbf78e5001d89af911b435c1ba1424/Screenshot-2025-02-18-at-5.02.10AM.png" data-mid="226756251" border="0" src="https://freight.cargo.site/w/1000/i/82342fad87a1a53a565db93ad4685af4c6fbf78e5001d89af911b435c1ba1424/Screenshot-2025-02-18-at-5.02.10AM.png" /> 3D modeling <img width="3262" height="1844" width_o="3262" height_o="1844" data-src="https://freight.cargo.site/t/original/i/bc3398ede0e67ba6bda24753388bdaefc14d4bbe57331f1bf1384f6813b7626f/Screenshot-2025-02-18-at-5.00.34AM.png" data-mid="226756225" border="0" src="https://freight.cargo.site/w/1000/i/bc3398ede0e67ba6bda24753388bdaefc14d4bbe57331f1bf1384f6813b7626f/Screenshot-2025-02-18-at-5.00.34AM.png" /> Metal Laser Cut <img width="1024" height="768" width_o="1024" height_o="768" data-src="https://freight.cargo.site/t/original/i/47335aa658aea591837c165a6d05f8910ac419ddc372020da80ea59939aba4d0/5ECD7BCC-6A1C-4061-9E69-010967EC8CD1_1_105_c.jpeg" data-mid="226755159" border="0" src="https://freight.cargo.site/w/1000/i/47335aa658aea591837c165a6d05f8910ac419ddc372020da80ea59939aba4d0/5ECD7BCC-6A1C-4061-9E69-010967EC8CD1_1_105_c.jpeg" /> <img width="1024" height="768" width_o="1024" height_o="768" data-src="https://freight.cargo.site/t/original/i/b3dbb4e909c87c972b78c8aaab7e5131ebc9469be4fe994ae6c5a69676c5df86/7063E1F1-2E4A-4244-9BB0-FE3315704090_1_105_c.jpeg" data-mid="226755175" border="0" src="https://freight.cargo.site/w/1000/i/b3dbb4e909c87c972b78c8aaab7e5131ebc9469be4fe994ae6c5a69676c5df86/7063E1F1-2E4A-4244-9BB0-FE3315704090_1_105_c.jpeg" /> <img width="1024" height="768" width_o="1024" height_o="768" data-src="https://freight.cargo.site/t/original/i/d22dea8f0615e7a593fcca9eab913f299462694dac0b88e7a3581a44b800741e/0513A0E2-F8DD-4A11-8985-5C568A988719_1_105_c.jpeg" data-mid="226754427" border="0" src="https://freight.cargo.site/w/1000/i/d22dea8f0615e7a593fcca9eab913f299462694dac0b88e7a3581a44b800741e/0513A0E2-F8DD-4A11-8985-5C568A988719_1_105_c.jpeg" /> <img width="2048" height="1536" width_o="2048" height_o="1536" data-src="https://freight.cargo.site/t/original/i/6d26a13bf6b3e0b050d7161f247bf0fcbf9e1ec9c7ad69df8961ddfcd4aac989/519F0E05-04AC-4AE5-BB7D-F455E5C67BBF_1_102_o.jpeg" data-mid="226754744" border="0" src="https://freight.cargo.site/w/1000/i/6d26a13bf6b3e0b050d7161f247bf0fcbf9e1ec9c7ad69df8961ddfcd4aac989/519F0E05-04AC-4AE5-BB7D-F455E5C67BBF_1_102_o.jpeg" /> Assembly <img width="768" height="1024" width_o="768" height_o="1024" data-src="https://freight.cargo.site/t/original/i/70ac8cf814da875480e676e5d863490c4edee20991d28797419b5629a87dc4d4/EE8E6D58-0F6D-48BE-80BE-0DD8F5F79E11_1_105_c.jpeg" data-mid="226754883" border="0" src="https://freight.cargo.site/w/768/i/70ac8cf814da875480e676e5d863490c4edee20991d28797419b5629a87dc4d4/EE8E6D58-0F6D-48BE-80BE-0DD8F5F79E11_1_105_c.jpeg" /> <img width="1536" height="2048" width_o="1536" height_o="2048" data-src="https://freight.cargo.site/t/original/i/c40be381b81dcc28555febc71d654eabeafe39343b995f84b558ca0ef5ef6d64/8EEEFCB7-D8B3-47DB-9676-2255BA8EDACD_1_102_o.jpeg" data-mid="226754779" border="0" src="https://freight.cargo.site/w/1000/i/c40be381b81dcc28555febc71d654eabeafe39343b995f84b558ca0ef5ef6d64/8EEEFCB7-D8B3-47DB-9676-2255BA8EDACD_1_102_o.jpeg" /> <img width="1536" height="2048" width_o="1536" height_o="2048" data-src="https://freight.cargo.site/t/original/i/9e4d76c03f3d34e232ae2f0f980df0f80a61d267d9b221017f83b4e3d1e2bad9/D20DF6E6-E66D-4202-B565-10EB010BD9A7_1_102_o.jpeg" data-mid="226754812" border="0" src="https://freight.cargo.site/w/1000/i/9e4d76c03f3d34e232ae2f0f980df0f80a61d267d9b221017f83b4e3d1e2bad9/D20DF6E6-E66D-4202-B565-10EB010BD9A7_1_102_o.jpeg" /><img width="1024" height="768" width_o="1024" height_o="768" data-src="https://freight.cargo.site/t/original/i/9a96d86cddd48bffbcd83a88ae1d8a353dccc77c0d6f0223fb36c488f918add2/BE66F1DA-1CFA-4F75-BF7A-8F63377F214A_1_105_c.jpeg" data-mid="226754749" border="0" src="https://freight.cargo.site/w/1000/i/9a96d86cddd48bffbcd83a88ae1d8a353dccc77c0d6f0223fb36c488f918add2/BE66F1DA-1CFA-4F75-BF7A-8F63377F214A_1_105_c.jpeg" /> Media Coverage MIT News <img width="3106" height="2388" width_o="3106" height_o="2388" data-src="https://freight.cargo.site/t/original/i/804a0523d9b6ba9c6f615ab4baf8c83e15d593741d82d15160ac759af79dbdbb/Screenshot-2025-02-17-at-9.47.40PM.png" data-mid="226743781" border="0" src="https://freight.cargo.site/w/1000/i/804a0523d9b6ba9c6f615ab4baf8c83e15d593741d82d15160ac759af79dbdbb/Screenshot-2025-02-17-at-9.47.40PM.png" /> MIT Morningside Design Academy <img width="4112" height="2566" width_o="4112" height_o="2566" data-src="https://freight.cargo.site/t/original/i/6cc173b3886249f1457a41505de48d82c47b8d3b8da2f949422c0e922f92e6cc/MIT_MAD_News_Memorscope.png" data-mid="226744366" border="0" src="https://freight.cargo.site/w/1000/i/6cc173b3886249f1457a41505de48d82c47b8d3b8da2f949422c0e922f92e6cc/MIT_MAD_News_Memorscope.png" /> https://kimkeunwook.com/AlterEgo Mon, 06 Oct 2025 20:24:03 +0000 kimkeunwook https://kimkeunwook.com/AlterEgo AlterEgo Industrial Design, Early concept&nbsp;2024https://www.alterego.io/ Interact at the speed of thought Introducing AlterEgo, the first near-telepathic interface, designed to make technology as intuitive as using your inner voice. Wired device shown is a pre-production prototype AlterEgo is a breakthrough technology, developed at MIT, that connects you with AI through a minimal, non-invasive device. Using Silent Sense, it understands what you intend to say without speaking, allowing you to extend your thinking without the need to type, tap, or talk out loud. Participated as an industrial designer for early concept design <img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/1b1fd4df4c8f0faa8e637adb007b31740b92073173000c421011374b1c816d7a/AlterEgo_thumnail.png" data-mid="239086180" border="0" src="https://freight.cargo.site/w/1000/i/1b1fd4df4c8f0faa8e637adb007b31740b92073173000c421011374b1c816d7a/AlterEgo_thumnail.png" /> https://kimkeunwook.com/Core-Memory Mon, 19 May 2025 23:19:55 +0000 kimkeunwook https://kimkeunwook.com/Core-Memory Core Memory&nbsp; WIP: This page will be updated regularlyReimagining Memory: A New Interface for Capturing and Sharing Memories, 2024 ~ (On Going) &nbsp;This project stared as an extension of Memorscope (Click the link!). Imagine you’ve gone on a trip with your family and friends.What if you could revisit those precious memories without sifting through hundreds of photos dumped into a shared album that you never actually look back at?Memorscope is an AI-powered Collective Memory sharing device. It was presented at NeurIPS, one of the biggest AI conferences, and presented at MIT News. But it didn’t solve the problem—it was more of an artwork. Still, it revealed a hint: What if we could create one image that understands the context and stories behind your many photos? What if we could talk to that picture? What if we could zoom in—and dive deeper into the memory? What if we could archive our lives as contextualized stories—not as a data graveyard? I take many many photos. <img width="2252" height="1808" width_o="2252" height_o="1808" data-src="https://freight.cargo.site/t/original/i/a4576a5143c1e456ac5d80622cec8943368b8ddd62e9b3af13e38a49cbae234c/Screenshot-2025-05-28-at-2.31.34PM.png" data-mid="233851916" border="0" data-scale="51" src="https://freight.cargo.site/w/1000/i/a4576a5143c1e456ac5d80622cec8943368b8ddd62e9b3af13e38a49cbae234c/Screenshot-2025-05-28-at-2.31.34PM.png" /> Like, a lot. As of today, I have more than 200,000 items in my photo album. And I’m not alone. I talked to friends, and many of them do the same. We document everything — but then what? What do we do with those photos? Do we go back and look at them? For me, the photo app just feels like a grid. It’s not a memory — it’s just a storage system. It’s a shelf, neatly arranged by time. So what I wanted was to turn this grid into something else — a story interface, not just a timeline. <img width="2612" height="974" width_o="2612" height_o="974" data-src="https://freight.cargo.site/t/original/i/c4cf44b0013ee143c03d73d6e51ee9b0432e7932aafd2033d68109dc691e6d69/Screenshot-2025-05-28-at-2.51.30PM.png" data-mid="233851961" border="0" src="https://freight.cargo.site/w/1000/i/c4cf44b0013ee143c03d73d6e51ee9b0432e7932aafd2033d68109dc691e6d69/Screenshot-2025-05-28-at-2.51.30PM.png" />Turing data into stories Meanwhile,&nbsp;The current technologies are asking questions to us :&nbsp; Is memory what happened? Or is it what we choose to remember? If you’re team ‘what we choose to remember’, then your friend is Google. (Read: Google says Pixel cameras don’t take photos, they create memories) They allow you to take a selfie and put whatever you want - like, a UFO!<img width="2508" height="1448" width_o="2508" height_o="1448" data-src="https://freight.cargo.site/t/original/i/2a46c3d123e74a4c0dc37588edb893b4dca1066b28a342f5422e0bde2b8062dd/Screenshot-2025-05-28-at-5.39.05PM.png" data-mid="233861502" border="0" src="https://freight.cargo.site/w/1000/i/2a46c3d123e74a4c0dc37588edb893b4dca1066b28a342f5422e0bde2b8062dd/Screenshot-2025-05-28-at-5.39.05PM.png" /> If you’re team ‘what happened’, then your friend is Apple.They offer traditional digital ‘camera features’, not a crazy ‘add a UFO feature’<img width="2584" height="1422" width_o="2584" height_o="1422" data-src="https://freight.cargo.site/t/original/i/4f0357e9da5b4755df1fa96a03b52b586b33dde3c03f7477f2842e9091fb659c/Screenshot-2025-05-28-at-5.39.30PM.png" data-mid="233861506" border="0" src="https://freight.cargo.site/w/1000/i/4f0357e9da5b4755df1fa96a03b52b586b33dde3c03f7477f2842e9091fb659c/Screenshot-2025-05-28-at-5.39.30PM.png" />What if there is an alternative? What if, we could create a picture of one day of your life compressed not as data, but as a story?What if, we could have one picture of our days, weeks, months, and years? Core Memory is a contextual memory AI interface that blends wearable sensing, generative AI, and ambient interaction to create a new way of engaging with personal memory. Technical foundations The product takes the form of: • A wearable device with a camera, microphone, and IMU sensors for passive, context-rich capture (time, location, motion, audio-visual cues) • A memory engine built on large language models and vision models, clustering and summarizing life fragments into narrative sequences • A story generation layer that uses generative image models to produce blended visual memories—evoking emotional context, not just factual recall • A gesture-driven projection system for ambient, physical interaction with memory • A supporting mobile/web interface for browsing, editing, and sharing Rather than serving as a passive archive, Core Memory acts as a contextual assistant for memory—retrieving, generating, and blending media based on time, location, people, and emotional tone. This is not a one-step launch; it’s a step-by-step system. I will begin by releasing the mobile/web app to validate the interaction model and build an active user base. In parallel, I’ll develop and test the wearable hardware prototype with a smaller group, moving toward a seamless, integrated experience over time. Ultimately, Core Memory lays the technical foundation for a longer-term vision: rethinking memory as a form of active reflection and human authorship, with AI supporting—not replacing—the storyteller. The Past and PresentHistory of Lifelogging devices and interfaces - focused on visual information <img width="1920" height="1074" width_o="1920" height_o="1074" data-src="https://freight.cargo.site/t/original/i/9706858477ea524b3374e1f224a1bfbcd83afdebfd8bd6b0147424bc7b11e6d0/ezgif.com-animated-gif-maker-1.gif" data-mid="233851832" border="0" src="https://freight.cargo.site/w/1000/i/9706858477ea524b3374e1f224a1bfbcd83afdebfd8bd6b0147424bc7b11e6d0/ezgif.com-animated-gif-maker-1.gif" /> Precedents A - failed research prototypesfrom As We May Think to Gorden Bell’s Mylifebits <img width="1760" height="1496" width_o="1760" height_o="1496" data-src="https://freight.cargo.site/t/original/i/1c3153542968a6b55508ec5575d3388a73b9e8aa029fccdc29200f2cc6a7bde6/Screenshot-2025-05-28-at-2.53.31PM.png" data-mid="233851936" border="0" data-scale="47" src="https://freight.cargo.site/w/1000/i/1c3153542968a6b55508ec5575d3388a73b9e8aa029fccdc29200f2cc6a7bde6/Screenshot-2025-05-28-at-2.53.31PM.png" /> Precedents B - Current productsMy review of Humane AI Pin / Rabbit R1 / Meta Raybans(Click) <img width="1282" height="846" width_o="1282" height_o="846" data-src="https://freight.cargo.site/t/original/i/12ad6f4e93e2ba7e045ebd57ea59fef5093dc06fc82216e2aa6e77133dd5fa27/Screenshot-2025-06-03-at-2.54.27PM.png" data-mid="234128819" border="0" src="https://freight.cargo.site/w/1000/i/12ad6f4e93e2ba7e045ebd57ea59fef5093dc06fc82216e2aa6e77133dd5fa27/Screenshot-2025-06-03-at-2.54.27PM.png" /> <img width="1098" height="734" width_o="1098" height_o="734" data-src="https://freight.cargo.site/t/original/i/053996b75d64ed7b69bc9a2b3e5d06d9a1fe2d9a24cee179b744778c24498d56/Screenshot-2025-06-03-at-2.54.17PM.png" data-mid="234128818" border="0" src="https://freight.cargo.site/w/1000/i/053996b75d64ed7b69bc9a2b3e5d06d9a1fe2d9a24cee179b744778c24498d56/Screenshot-2025-06-03-at-2.54.17PM.png" /> <img width="1118" height="916" width_o="1118" height_o="916" data-src="https://freight.cargo.site/t/original/i/278e6125c85c4406be156f0b5a092e4a4d8658f22f50fb8193a8a5456570241e/Screenshot-2025-06-03-at-2.53.59PM.png" data-mid="234128816" border="0" src="https://freight.cargo.site/w/1000/i/278e6125c85c4406be156f0b5a092e4a4d8658f22f50fb8193a8a5456570241e/Screenshot-2025-06-03-at-2.53.59PM.png" /> The Future of... CaptureEarbuds<img width="1600" height="1000" width_o="1600" height_o="1000" data-src="https://freight.cargo.site/t/original/i/d27af29bfd7a5eccb26e80be8c5209601dfc31dd80c17a1d5d3af1f060dbf607/ezgif.com-animated-gif-maker.gif" data-mid="233849395" border="0" src="https://freight.cargo.site/w/1000/i/d27af29bfd7a5eccb26e80be8c5209601dfc31dd80c17a1d5d3af1f060dbf607/ezgif.com-animated-gif-maker.gif" /> Share - DemoStory Interface - Zoom in Interactioninspired from infinitly zoomable artworks (https://www.youtube.com/watch?v=nMtCMjMbURY) Process - Design Ideation and Iterations<img width="2664" height="1492" width_o="2664" height_o="1492" data-src="https://freight.cargo.site/t/original/i/b32c7fc819303ffdceb9b1d138bf054107875028c1df1e03a525ea28b5563d54/Screenshot-2025-05-28-at-2.52.20PM.png" data-mid="233851933" border="0" src="https://freight.cargo.site/w/1000/i/b32c7fc819303ffdceb9b1d138bf054107875028c1df1e03a525ea28b5563d54/Screenshot-2025-05-28-at-2.52.20PM.png" />3D modeling Process&nbsp; for both Memory-Capture wearable and Home device <img width="3254" height="2076" width_o="3254" height_o="2076" data-src="https://freight.cargo.site/t/original/i/a24c4848d482024ca99eadc37400b7389d44d17156992d5ea645f598ba70d8f8/Screenshot-2025-05-28-at-4.57.57PM.png" data-mid="233860518" border="0" src="https://freight.cargo.site/w/1000/i/a24c4848d482024ca99eadc37400b7389d44d17156992d5ea645f598ba70d8f8/Screenshot-2025-05-28-at-4.57.57PM.png" /> &nbsp; https://kimkeunwook.com/Thought-Bubbles Mon, 30 Mar 2026 23:14:33 +0000 kimkeunwook https://kimkeunwook.com/Thought-Bubbles Thought BubblesWhat if we had physical thought bubbles, just like straight out of cartoons?, 2025 ~ (On Going) <img width="1920" height="1241" width_o="1920" height_o="1241" data-src="https://freight.cargo.site/t/original/i/e2c25fa224b5c120e1217b209b4dc397eae2aa699a5fea9827e58933f31fbbcb/ezgif-48061a7c96cedb7d.gif" data-mid="246702880" border="0" src="https://freight.cargo.site/w/1000/i/e2c25fa224b5c120e1217b209b4dc397eae2aa699a5fea9827e58933f31fbbcb/ezgif-48061a7c96cedb7d.gif" /> <img width="1850" height="1534" width_o="1850" height_o="1534" data-src="https://freight.cargo.site/t/original/i/fa6dfea467eab2d5849552cb47b86322d0b65f306779a05e5707e670a4328603/Screenshot-2026-03-30-at-7.05.43PM.png" data-mid="246702875" border="0" src="https://freight.cargo.site/w/1000/i/fa6dfea467eab2d5849552cb47b86322d0b65f306779a05e5707e670a4328603/Screenshot-2026-03-30-at-7.05.43PM.png" /><img width="1592" height="1634" width_o="1592" height_o="1634" data-src="https://freight.cargo.site/t/original/i/5887374a96ebbd5229b644d4598088ad01c59a96b613719766d7235abef4ae2a/Screenshot-2026-03-30-at-7.05.40PM.png" data-mid="246702876" border="0" src="https://freight.cargo.site/w/1000/i/5887374a96ebbd5229b644d4598088ad01c59a96b613719766d7235abef4ae2a/Screenshot-2026-03-30-at-7.05.40PM.png" /><img width="2030" height="1440" width_o="2030" height_o="1440" data-src="https://freight.cargo.site/t/original/i/770ecac55d33f98c043522764af27d9b304bbe0e22b922564308023e2fc94a98/Screenshot-2026-03-30-at-7.06.37PM.png" data-mid="246702874" border="0" src="https://freight.cargo.site/w/1000/i/770ecac55d33f98c043522764af27d9b304bbe0e22b922564308023e2fc94a98/Screenshot-2026-03-30-at-7.06.37PM.png" /><img width="653" height="1073" width_o="653" height_o="1073" data-src="https://freight.cargo.site/t/original/i/04b4d5bba0fef58b213b11e8c7270056126dac2bc94f298a33a2dbf6b74803f6/thought-balloon-Superman.jpg" data-mid="246702882" border="0" data-scale="49" src="https://freight.cargo.site/w/653/i/04b4d5bba0fef58b213b11e8c7270056126dac2bc94f298a33a2dbf6b74803f6/thought-balloon-Superman.jpg" /> &nbsp;This project stared as an extension of Memorscope (Click the link!). Imagine you’ve gone on a trip with your family and friends.What if you could revisit those precious memories without sifting through hundreds of photos dumped into a shared album that you never actually look back at?Memorscope is an AI-powered Collective Memory sharing device. It was presented at NeurIPS, one of the biggest AI conferences, and presented at MIT News. But it didn’t solve the problem—it was more of an artwork. Still, it revealed a hint: What if we could create one image that understands the context and stories behind your many photos? What if we could talk to that picture? What if we could zoom in—and dive deeper into the memory? What if we could archive our lives as contextualized stories—not as a data graveyard? I take many many photos. <img width="2252" height="1808" width_o="2252" height_o="1808" data-src="https://freight.cargo.site/t/original/i/a4576a5143c1e456ac5d80622cec8943368b8ddd62e9b3af13e38a49cbae234c/Screenshot-2025-05-28-at-2.31.34PM.png" data-mid="246702844" border="0" data-scale="51" src="https://freight.cargo.site/w/1000/i/a4576a5143c1e456ac5d80622cec8943368b8ddd62e9b3af13e38a49cbae234c/Screenshot-2025-05-28-at-2.31.34PM.png" /> Like, a lot. As of today, I have more than 200,000 items in my photo album. And I’m not alone. I talked to friends, and many of them do the same. We document everything — but then what? What do we do with those photos? Do we go back and look at them? For me, the photo app just feels like a grid. It’s not a memory — it’s just a storage system. It’s a shelf, neatly arranged by time. &nbsp; https://kimkeunwook.com/Compass3-0X Tue, 18 Feb 2025 10:14:41 +0000 kimkeunwook https://kimkeunwook.com/Compass3-0X Compass3.0X AI Compass, Speculative Design, 2024Industrial design, Interaction design, Creative direction Collaborated with : Kohui, Seungmin LeePresented at : Design Korea Make the best decision at every moment. With the power of AI, every choice becomes simple. COMPASS 3.0X has all the answers prepared just for you. &nbsp;Equipped with cutting-edge AI technology developed by researchers from MIT and Harvard, this revolutionary device will guide your life in a smarter way. By combining the mysteries of the universe with big data, COMPASS 3.0X transforms every decision you make. &nbsp; &nbsp;Leave your choices to COMPASS 3.0X. With COMPASS 3.0X by your side, every moment becomes the perfect choice. Smarter and more efficient decisions seamlessly integrate into your daily life. &nbsp; Every decision made with COMPASS 3.0X is always the best one. With COMPASS 3.0X, even the possibilities of the universe are in your hands. We invented Compass 3.0X to critique the AI hype and the blind pursuit of integrating AI into tools—especially in design—ironically, at a conference dedicated to AI in Design. We delivered our talk as if we were an innovative tech startup, but eventually, we revealed the truth—discussing the concept of “vaporware” and why we believe we are already using Compass 3.0X. In reality, we rely on external influences for everyday decisions, from choosing a lunch menu to making life-altering choices like divorce. Exhibition &amp; Talk : Design Korea 2024, 11.12 - 11.16, Coex Prompt: Should I devorce or keep the relationship? Exhibition Installation <img width="6000" height="4000" width_o="6000" height_o="4000" data-src="https://freight.cargo.site/t/original/i/af004745846bc3ae5a273216b952840fdef66486c5019c635f5b37c38ece8996/DSC00141.JPG" data-mid="226806271" border="0" src="https://freight.cargo.site/w/1000/i/af004745846bc3ae5a273216b952840fdef66486c5019c635f5b37c38ece8996/DSC00141.JPG" /> Device Activation <img width="6000" height="4000" width_o="6000" height_o="4000" data-src="https://freight.cargo.site/t/original/i/7df05a3c0ac0625121e7fb2aec93326ae6337a1ddc0871fa8111248c51d5bd58/DSC00105.JPG" data-mid="226806239" border="0" src="https://freight.cargo.site/w/1000/i/7df05a3c0ac0625121e7fb2aec93326ae6337a1ddc0871fa8111248c51d5bd58/DSC00105.JPG" /> <img width="6000" height="4000" width_o="6000" height_o="4000" data-src="https://freight.cargo.site/t/original/i/b266e3ebf4bdd73bd916ac0b20acb461f78f3d2eebc750ecb2b491d21a56e7f8/DSC00161.JPG" data-mid="226806334" border="0" src="https://freight.cargo.site/w/1000/i/b266e3ebf4bdd73bd916ac0b20acb461f78f3d2eebc750ecb2b491d21a56e7f8/DSC00161.JPG" /> Talk We joined a talk at Seoul, from Seoul(Kohui), Boston(Keunwook), and LA(Seungmin) <img width="3800" height="2140" width_o="3800" height_o="2140" data-src="https://freight.cargo.site/t/original/i/2546ae3d96d60db5689998f95e0978c028bc37fb07d5be94e8bb1ed7b7fb6eda/Screenshot-2025-02-18-at-12.04.34PM.png" data-mid="226806497" border="0" src="https://freight.cargo.site/w/1000/i/2546ae3d96d60db5689998f95e0978c028bc37fb07d5be94e8bb1ed7b7fb6eda/Screenshot-2025-02-18-at-12.04.34PM.png" /> <img width="3822" height="2142" width_o="3822" height_o="2142" data-src="https://freight.cargo.site/t/original/i/7656dbfea6c8a130dac94b53daff10cc14cf97d8812dcb62946d91b20553ba82/Screenshot-2025-02-18-at-12.05.18PM.png" data-mid="226806611" border="0" src="https://freight.cargo.site/w/1000/i/7656dbfea6c8a130dac94b53daff10cc14cf97d8812dcb62946d91b20553ba82/Screenshot-2025-02-18-at-12.05.18PM.png" /> Process Inspiration : Luopan The oldest precursors of the luopan are the 式;&nbsp;shì&nbsp;or&nbsp;式盤;&nbsp;shìpán, meaning astrolabe or&nbsp;diviner's board—also sometimes called&nbsp;&nbsp;liuren&nbsp;astrolabes[5]—unearthed from tombs that date between 278 BCE and 209 BCE. <img width="868" height="1222" width_o="868" height_o="1222" data-src="https://freight.cargo.site/t/original/i/45dd20cfe286c9cc3e283935bd18d406fb2d25c5ddbb9f4b785c4b79a49e0edb/Screenshot-2025-02-18-at-12.13.45PM.png" data-mid="226808252" border="0" src="https://freight.cargo.site/w/868/i/45dd20cfe286c9cc3e283935bd18d406fb2d25c5ddbb9f4b785c4b79a49e0edb/Screenshot-2025-02-18-at-12.13.45PM.png" /> <img width="1994" height="1448" width_o="1994" height_o="1448" data-src="https://freight.cargo.site/t/original/i/7975322acbcf44f3b0bb0a10291e50f8a028662abab9ea9e15ae626f0c89541b/Screenshot-2025-02-18-at-12.13.37PM.png" data-mid="226808237" border="0" src="https://freight.cargo.site/w/1000/i/7975322acbcf44f3b0bb0a10291e50f8a028662abab9ea9e15ae626f0c89541b/Screenshot-2025-02-18-at-12.13.37PM.png" /> <img width="4244" height="2832" width_o="4244" height_o="2832" data-src="https://freight.cargo.site/t/original/i/d94c2ec1493b9c0e34759adb4a0ba94c868955236392515b63db8e37e574daf5/Screenshot-2025-02-18-at-12.13.21PM.png" data-mid="226808196" border="0" src="https://freight.cargo.site/w/1000/i/d94c2ec1493b9c0e34759adb4a0ba94c868955236392515b63db8e37e574daf5/Screenshot-2025-02-18-at-12.13.21PM.png" /> <img width="1408" height="1032" width_o="1408" height_o="1032" data-src="https://freight.cargo.site/t/original/i/48d215b7dd5fe008688ef819f34dc1bc9f8c54da8b32c46bfe427fdc43c9ae54/Screenshot-2025-02-18-at-12.13.01PM.png" data-mid="226808146" border="0" src="https://freight.cargo.site/w/1000/i/48d215b7dd5fe008688ef819f34dc1bc9f8c54da8b32c46bfe427fdc43c9ae54/Screenshot-2025-02-18-at-12.13.01PM.png" /> Initial Form Factor Skecthces / Form Study <img width="3882" height="1542" width_o="3882" height_o="1542" data-src="https://freight.cargo.site/t/original/i/93da4a2a9a01e0cd2b62501956525b46bd6cdb27183f6ef13a0bbff564753a67/Screenshot-2025-02-18-at-12.11.56PM.png" data-mid="226807868" border="0" src="https://freight.cargo.site/w/1000/i/93da4a2a9a01e0cd2b62501956525b46bd6cdb27183f6ef13a0bbff564753a67/Screenshot-2025-02-18-at-12.11.56PM.png" /> <img width="1408" height="994" width_o="1408" height_o="994" data-src="https://freight.cargo.site/t/original/i/5998d76b7376aeef2cdd3ae37e78debce3feab0a178d61ef3f6055b62870eed2/Screenshot-2025-02-18-at-12.10.39PM.png" data-mid="226807643" border="0" src="https://freight.cargo.site/w/1000/i/5998d76b7376aeef2cdd3ae37e78debce3feab0a178d61ef3f6055b62870eed2/Screenshot-2025-02-18-at-12.10.39PM.png" /> <img width="1410" height="1082" width_o="1410" height_o="1082" data-src="https://freight.cargo.site/t/original/i/c7b542587e5eec9d3758e7c0b4ff80f40cb1e4ca09218c090b0fab3fc5f556f7/Screenshot-2025-02-18-at-12.10.50PM.png" data-mid="226807662" border="0" data-scale="92" src="https://freight.cargo.site/w/1000/i/c7b542587e5eec9d3758e7c0b4ff80f40cb1e4ca09218c090b0fab3fc5f556f7/Screenshot-2025-02-18-at-12.10.50PM.png" /> <img width="3320" height="3040" width_o="3320" height_o="3040" data-src="https://freight.cargo.site/t/original/i/fb5ab8d6a7ffe5626a360490faa123afeb9d178be79f0825f263fcd4117fbcde/Screenshot-2025-02-18-at-12.12.32PM.png" data-mid="226808060" border="0" src="https://freight.cargo.site/w/1000/i/fb5ab8d6a7ffe5626a360490faa123afeb9d178be79f0825f263fcd4117fbcde/Screenshot-2025-02-18-at-12.12.32PM.png" /> <img width="3350" height="3030" width_o="3350" height_o="3030" data-src="https://freight.cargo.site/t/original/i/7dfeeb34b6f9531f5342cf3b4110b30d8709882bd7588125fe38dedcb5a917a9/Screenshot-2025-02-18-at-12.12.17PM.png" data-mid="226807969" border="0" src="https://freight.cargo.site/w/1000/i/7dfeeb34b6f9531f5342cf3b4110b30d8709882bd7588125fe38dedcb5a917a9/Screenshot-2025-02-18-at-12.12.17PM.png" /> <img width="1406" height="800" width_o="1406" height_o="800" data-src="https://freight.cargo.site/t/original/i/321ae2b4b1fe140d8e8314a183ded04f8a75fd08021f84a3fb0c7b85f37f4de0/Screenshot-2025-02-18-at-12.11.39PM.png" data-mid="226807805" border="0" src="https://freight.cargo.site/w/1000/i/321ae2b4b1fe140d8e8314a183ded04f8a75fd08021f84a3fb0c7b85f37f4de0/Screenshot-2025-02-18-at-12.11.39PM.png" /> <img width="1412" height="1388" width_o="1412" height_o="1388" data-src="https://freight.cargo.site/t/original/i/3762718d80702e378dab39af2a047704593646fd1a227c782c8e481bf2acd55b/Screenshot-2025-02-18-at-12.11.32PM.png" data-mid="226807772" border="0" src="https://freight.cargo.site/w/1000/i/3762718d80702e378dab39af2a047704593646fd1a227c782c8e481bf2acd55b/Screenshot-2025-02-18-at-12.11.32PM.png" /> <img width="1408" height="1140" width_o="1408" height_o="1140" data-src="https://freight.cargo.site/t/original/i/5e4943544d6b3ed7f16b245faab32d437c9a866da93a8b057e242881c453c1b2/Screenshot-2025-02-18-at-12.11.16PM.png" data-mid="226807723" border="0" src="https://freight.cargo.site/w/1000/i/5e4943544d6b3ed7f16b245faab32d437c9a866da93a8b057e242881c453c1b2/Screenshot-2025-02-18-at-12.11.16PM.png" /> <img width="1406" height="1098" width_o="1406" height_o="1098" data-src="https://freight.cargo.site/t/original/i/9007ab7cfb4d814843854826786d75e9fefe66b0cc7e3165b0a75d72fe44d46d/Screenshot-2025-02-18-at-12.11.23PM.png" data-mid="226807743" border="0" src="https://freight.cargo.site/w/1000/i/9007ab7cfb4d814843854826786d75e9fefe66b0cc7e3165b0a75d72fe44d46d/Screenshot-2025-02-18-at-12.11.23PM.png" /> <img width="1788" height="1270" width_o="1788" height_o="1270" data-src="https://freight.cargo.site/t/original/i/c6d4f8f3dc27ae83f42993e1136f369916430cc394756385ff96dd4a918105b3/Screenshot-2025-02-18-at-3.54.22PM.png" data-mid="226827553" border="0" src="https://freight.cargo.site/w/1000/i/c6d4f8f3dc27ae83f42993e1136f369916430cc394756385ff96dd4a918105b3/Screenshot-2025-02-18-at-3.54.22PM.png" /> <img width="1804" height="1334" width_o="1804" height_o="1334" data-src="https://freight.cargo.site/t/original/i/ace9178f232368c54227a71b64095eafa6002d2ac81961bd34e37aa4af24b046/Screenshot-2025-02-18-at-3.54.14PM.png" data-mid="226827554" border="0" src="https://freight.cargo.site/w/1000/i/ace9178f232368c54227a71b64095eafa6002d2ac81961bd34e37aa4af24b046/Screenshot-2025-02-18-at-3.54.14PM.png" /> <img width="1718" height="1278" width_o="1718" height_o="1278" data-src="https://freight.cargo.site/t/original/i/575a7e76d3cd5f98db548f39eb83ae27774830f4330d4a14c36c0fa164706b74/Screenshot-2025-02-18-at-3.54.01PM.png" data-mid="226827555" border="0" src="https://freight.cargo.site/w/1000/i/575a7e76d3cd5f98db548f39eb83ae27774830f4330d4a14c36c0fa164706b74/Screenshot-2025-02-18-at-3.54.01PM.png" /> <img width="1842" height="1416" width_o="1842" height_o="1416" data-src="https://freight.cargo.site/t/original/i/70efc44704d9c318fa7d3c87f9c8644070df2c25debe5f2f49c099baeeb81692/Screenshot-2025-02-18-at-3.53.45PM.png" data-mid="226827556" border="0" src="https://freight.cargo.site/w/1000/i/70efc44704d9c318fa7d3c87f9c8644070df2c25debe5f2f49c099baeeb81692/Screenshot-2025-02-18-at-3.53.45PM.png" /> <img width="2084" height="1676" width_o="2084" height_o="1676" data-src="https://freight.cargo.site/t/original/i/71a11019bbcf4b34bde4924f681c9613ea65f15c909c6872ade95d80abeedc0a/Screenshot-2025-02-18-at-3.53.39PM.png" data-mid="226827558" border="0" src="https://freight.cargo.site/w/1000/i/71a11019bbcf4b34bde4924f681c9613ea65f15c909c6872ade95d80abeedc0a/Screenshot-2025-02-18-at-3.53.39PM.png" /> <img width="2034" height="1526" width_o="2034" height_o="1526" data-src="https://freight.cargo.site/t/original/i/4dc535227c7519c8c3853fda26f8391e512f14cd62c3ea44bcb0775fe503aa07/Screenshot-2025-02-18-at-3.53.16PM.png" data-mid="226827559" border="0" src="https://freight.cargo.site/w/1000/i/4dc535227c7519c8c3853fda26f8391e512f14cd62c3ea44bcb0775fe503aa07/Screenshot-2025-02-18-at-3.53.16PM.png" /> Midjourney Experimentations <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/ffe9ac9cf5323824aa813f06382a44ef6437e42c26044c78077aa9b8cbb8def9/Pasted-Graphic-24.png" data-mid="226809294" border="0" src="https://freight.cargo.site/w/1000/i/ffe9ac9cf5323824aa813f06382a44ef6437e42c26044c78077aa9b8cbb8def9/Pasted-Graphic-24.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/c7f80f5afc5450dd312fa0fc3a8442b0410548fa143d362fc8e563fa770cacb0/Pasted-Graphic-25.png" data-mid="226809306" border="0" src="https://freight.cargo.site/w/1000/i/c7f80f5afc5450dd312fa0fc3a8442b0410548fa143d362fc8e563fa770cacb0/Pasted-Graphic-25.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/a31bbd3806f319b7bfbbf8e071675fd01d1c2f5fc0faaaafd303672057c70c7c/Pasted-Graphic-20.png" data-mid="226809381" border="0" src="https://freight.cargo.site/w/1000/i/a31bbd3806f319b7bfbbf8e071675fd01d1c2f5fc0faaaafd303672057c70c7c/Pasted-Graphic-20.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/5b2380e679d8813e146e4a7ab9523bffb1cb4a162a2b1de9ae7171509eed3868/Pasted-Graphic-17.png" data-mid="226809397" border="0" src="https://freight.cargo.site/w/1000/i/5b2380e679d8813e146e4a7ab9523bffb1cb4a162a2b1de9ae7171509eed3868/Pasted-Graphic-17.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/475f378cfd87adb9d5983f16a42bcefc76eb3606a72f5b9ca56236c3eb0eafd3/Pasted-Graphic-18.png" data-mid="226809430" border="0" src="https://freight.cargo.site/w/1000/i/475f378cfd87adb9d5983f16a42bcefc76eb3606a72f5b9ca56236c3eb0eafd3/Pasted-Graphic-18.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/e7ed960a19ac427e689df2f14b5da50ed1a39b1381b4beb8cbddb86d6508fa19/Pasted-Graphic-33.png" data-mid="226809419" border="0" src="https://freight.cargo.site/w/1000/i/e7ed960a19ac427e689df2f14b5da50ed1a39b1381b4beb8cbddb86d6508fa19/Pasted-Graphic-33.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/0f93792c8772d74d386e9ebcf23fd5276912b50e514cbf063ebdebb6267b06e2/Pasted-Graphic-26.png" data-mid="226809486" border="0" src="https://freight.cargo.site/w/1000/i/0f93792c8772d74d386e9ebcf23fd5276912b50e514cbf063ebdebb6267b06e2/Pasted-Graphic-26.png" /> <img width="1024" height="1024" width_o="1024" height_o="1024" data-src="https://freight.cargo.site/t/original/i/f61cc0df32086959fffaabf0b4bf4d2cfab9cbe92f080a0476bf518c515c73a0/Pasted-Graphic-31.png" data-mid="226809494" border="0" src="https://freight.cargo.site/w/1000/i/f61cc0df32086959fffaabf0b4bf4d2cfab9cbe92f080a0476bf518c515c73a0/Pasted-Graphic-31.png" /> Prototype Fabrication <img width="3048" height="1708" width_o="3048" height_o="1708" data-src="https://freight.cargo.site/t/original/i/03574a30f2833d78a91f04fa87b47df1008c41dfbab743a0c6b92253753977d9/Screenshot-2025-02-18-at-12.16.20PM.png" data-mid="226808690" border="0" src="https://freight.cargo.site/w/1000/i/03574a30f2833d78a91f04fa87b47df1008c41dfbab743a0c6b92253753977d9/Screenshot-2025-02-18-at-12.16.20PM.png" /><img width="3054" height="1718" width_o="3054" height_o="1718" data-src="https://freight.cargo.site/t/original/i/4562f22908a804601f2e5f4eeefa608041c3361e3c43ba847ff4a9065a39c914/Screenshot-2025-02-18-at-12.16.31PM.png" data-mid="226808707" border="0" src="https://freight.cargo.site/w/1000/i/4562f22908a804601f2e5f4eeefa608041c3361e3c43ba847ff4a9065a39c914/Screenshot-2025-02-18-at-12.16.31PM.png" /> <img width="3056" height="1716" width_o="3056" height_o="1716" data-src="https://freight.cargo.site/t/original/i/8fab5ec5b421dfa84d382e529334a5cbb4087e1ab7f145c65d3765925c3fbac7/Screenshot-2025-02-18-at-12.17.09PM.png" data-mid="226808795" border="0" src="https://freight.cargo.site/w/1000/i/8fab5ec5b421dfa84d382e529334a5cbb4087e1ab7f145c65d3765925c3fbac7/Screenshot-2025-02-18-at-12.17.09PM.png" />Planning <img width="1226" height="2090" width_o="1226" height_o="2090" data-src="https://freight.cargo.site/t/original/i/225ef8ddab25ff39ca82c6d896b3ff71396d7b528f0cc6b9f588e8fa4846fdec/Screenshot-2025-02-18-at-12.22.25PM.png" data-mid="226809866" border="0" src="https://freight.cargo.site/w/1000/i/225ef8ddab25ff39ca82c6d896b3ff71396d7b528f0cc6b9f588e8fa4846fdec/Screenshot-2025-02-18-at-12.22.25PM.png" /> <img width="938" height="1670" width_o="938" height_o="1670" data-src="https://freight.cargo.site/t/original/i/0e187c646308dd027bc14ab9e91ca7eb3f42638824ad129fe8a31f1b621dca0e/Screenshot-2025-02-18-at-12.22.35PM.png" data-mid="226809859" border="0" src="https://freight.cargo.site/w/938/i/0e187c646308dd027bc14ab9e91ca7eb3f42638824ad129fe8a31f1b621dca0e/Screenshot-2025-02-18-at-12.22.35PM.png" /> <img width="942" height="1670" width_o="942" height_o="1670" data-src="https://freight.cargo.site/t/original/i/d9f1e07508a5438d9fb31eaf6e23e1a511b94e50d04e4eb4d1039bc9ac0dbc58/Screenshot-2025-02-18-at-12.22.46PM.png" data-mid="226809854" border="0" src="https://freight.cargo.site/w/942/i/d9f1e07508a5438d9fb31eaf6e23e1a511b94e50d04e4eb4d1039bc9ac0dbc58/Screenshot-2025-02-18-at-12.22.46PM.png" /> <img width="2208" height="1124" width_o="2208" height_o="1124" data-src="https://freight.cargo.site/t/original/i/d17568829e910a8e8df6ebfb849122409670fc8b2c726faaa336815995e11898/Screenshot-2025-02-18-at-12.22.51PM.png" data-mid="226809845" border="0" src="https://freight.cargo.site/w/1000/i/d17568829e910a8e8df6ebfb849122409670fc8b2c726faaa336815995e11898/Screenshot-2025-02-18-at-12.22.51PM.png" /> <img width="1972" height="1108" width_o="1972" height_o="1108" data-src="https://freight.cargo.site/t/original/i/94447174c955df6ed1b7906dadd0d4b46af92d174273c6c12b273296b8117260/Screenshot-2025-02-18-at-12.22.57PM.png" data-mid="226809835" border="0" src="https://freight.cargo.site/w/1000/i/94447174c955df6ed1b7906dadd0d4b46af92d174273c6c12b273296b8117260/Screenshot-2025-02-18-at-12.22.57PM.png" /> <img width="1250" height="1664" width_o="1250" height_o="1664" data-src="https://freight.cargo.site/t/original/i/d297f4f41c6d125daf478726c02dc84ac3bed443ba3b64a1a78c571b7fa7b994/Screenshot-2025-02-18-at-12.23.00PM.png" data-mid="226809822" border="0" src="https://freight.cargo.site/w/1000/i/d297f4f41c6d125daf478726c02dc84ac3bed443ba3b64a1a78c571b7fa7b994/Screenshot-2025-02-18-at-12.23.00PM.png" /> Laser cut(Stainless Steel) / 3D print(Clear Resin, Form4) <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/46a88bf3c7bc15d348302d8fef379d5f8976b1298fe03b35b793a19225fec483/Compass3.0_Thumnail_process.png" data-mid="226829401" border="0" src="https://freight.cargo.site/w/1000/i/46a88bf3c7bc15d348302d8fef379d5f8976b1298fe03b35b793a19225fec483/Compass3.0_Thumnail_process.png" /> Presented at : Design Korea 2024 <img width="2428" height="1974" width_o="2428" height_o="1974" data-src="https://freight.cargo.site/t/original/i/99cec85d47f03fefa6402cc909675f5f9b89b555814f018bd8716318e09ba084/Screenshot-2025-02-18-at-12.24.51PM.png" data-mid="226810094" border="0" src="https://freight.cargo.site/w/1000/i/99cec85d47f03fefa6402cc909675f5f9b89b555814f018bd8716318e09ba084/Screenshot-2025-02-18-at-12.24.51PM.png" /> https://kimkeunwook.com/DNA-Interface Mon, 06 Oct 2025 22:46:49 +0000 kimkeunwook https://kimkeunwook.com/DNA-Interface DNA Interface : Write your name with your DNA Course Project: MAS.S61 How To Grow (Almost) Anything, MIT, 2024Synthetic Biology, Speculative Design, Prototyping Futures THIS PAGE WILL BE UPDATED SOON - PLEASE CHECK OUT THE NOTION PAGE UNTIL THEN (CLICK) Archive of the class projects including sessions and labs (Link)<img width="2654" height="1674" width_o="2654" height_o="1674" data-src="https://freight.cargo.site/t/original/i/5b8c4a875eeabb265bb20a3528fa1e01ec39abbe824d9c0120ac0f0e8b79ba2b/HTGAA_Device_thumnail.png" data-mid="239089402" border="0" src="https://freight.cargo.site/w/1000/i/5b8c4a875eeabb265bb20a3528fa1e01ec39abbe824d9c0120ac0f0e8b79ba2b/HTGAA_Device_thumnail.png" /><img width="2000" height="1489" width_o="2000" height_o="1489" data-src="https://freight.cargo.site/t/original/i/cd785228dcc179353dc5b19ca81660e70aff59298ac2d18fad5f6f56716e6c4f/DNA_Device_2.png" data-mid="239089675" border="0" src="https://freight.cargo.site/w/1000/i/cd785228dcc179353dc5b19ca81660e70aff59298ac2d18fad5f6f56716e6c4f/DNA_Device_2.png" /> <img width="1307" height="1313" width_o="1307" height_o="1313" data-src="https://freight.cargo.site/t/original/i/36dc2e50915e9cac9a3b65a80a797ab81f5c3bd0d35692acec82231622e0c93c/HTGAA_Thumnail.png" data-mid="239089261" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/36dc2e50915e9cac9a3b65a80a797ab81f5c3bd0d35692acec82231622e0c93c/HTGAA_Thumnail.png" /> <img width="2048" height="2731" width_o="2048" height_o="2731" data-src="https://freight.cargo.site/t/original/i/af427b44b2162fe70c371d90abba7de1dafaebdca210f2889b52cdb53c6d877f/IMG_6289.png" data-mid="239089670" border="0" src="https://freight.cargo.site/w/1000/i/af427b44b2162fe70c371d90abba7de1dafaebdca210f2889b52cdb53c6d877f/IMG_6289.png" /> DNA Interface - Three phases of DNA Interfaces Write your name with your DNA Hold your Emotion - What’s the physical form of emotion? Physical Twin of your body - What if we have a ‘ball’ made of actual DNA, protein, and everything we have interacting in sync with our actual body? Inspiration <img width="824" height="346" width_o="824" height_o="346" data-src="https://freight.cargo.site/t/original/i/2d0c1503f730b8d143714b77b2b5e43735fae17eeacb784f269dab980bf637d2/Vesper_1.png" data-mid="239089610" border="0" src="https://freight.cargo.site/w/824/i/2d0c1503f730b8d143714b77b2b5e43735fae17eeacb784f269dab980bf637d2/Vesper_1.png" /> <img width="2048" height="1462" width_o="2048" height_o="1462" data-src="https://freight.cargo.site/t/original/i/ff3784132f4eccff9db53f7463cd2e853ff1352821d471a0f34f88fd351f6b1f/Vesper_2.png" data-mid="239089611" border="0" src="https://freight.cargo.site/w/1000/i/ff3784132f4eccff9db53f7463cd2e853ff1352821d471a0f34f88fd351f6b1f/Vesper_2.png" /> <img width="2000" height="1335" width_o="2000" height_o="1335" data-src="https://freight.cargo.site/t/original/i/7144c3654d2a6e1e32ddd081bb96586e9362801b78471f1f55c3e25581ec3393/Vesper_3.png" data-mid="239089612" border="0" src="https://freight.cargo.site/w/1000/i/7144c3654d2a6e1e32ddd081bb96586e9362801b78471f1f55c3e25581ec3393/Vesper_3.png" />Vesper, Sci-fi Film 1. Write Your Name with Your DNA The use of DVespa also inspire futuristic applications of DNA interfaces. Exploring the concept of a 'DNA interface,' I envision a future where DNA can be used to store personal information, such as names or family pictures, and even synthesize hormones to physicalize human experiences or emotions. This innovative approach aligns with key research in the field, such as studies on fast and modular DNA computing by Chatterjee et al., and the semantics of DNA-based computation by Lakin and Phillips. Dalchau and colleagues' work on the synthesis and tuning of chemical reaction networks using DNA further illustrates the potential of this technology, providing a strong foundation for integrating DNA interfaces into interactive wearable devices. Reference papers: Gourab Chatterjee, Neil Dalchau, Richard A. Muscat, Andrew Phillips, Georg Seelig. "A spatially localized architecture for fast and modular DNA computing." Nature Nanotechnology, 2017. Matthew R. Lakin, Andrew Phillips. "A strand graph semantics for DNA-based computation." Theoretical Computer Science, 2016. Neil Dalchau, Niall Murphy, Rasmus Petersen, Boyan Yordanov. "Synthesizing and tuning chemical reaction networks with specified behaviours." International Conference on DNA Computing and Molecular Programming, 2015. 2. Hold Your Emotion - What’s the Physical Form of Emotion? What is emotion, anyway? What’s the physical form of emotion? In my project "Headspace," I explored the idea of physicalizing emotions through interactive and immersive installations. This concept can be extended using DNA-based interfaces to regulate and manifest emotional states. Researchers have developed DNA circuits and biosensors capable of detecting and responding to biochemical markers, paving the way for advanced health monitoring and therapeutic applications. For instance, hybridization chain reactions (HCR) have been employed to create highly sensitive biosensors that can detect specific RNA sequences within living cells, enabling precise monitoring of physiological states and emotional biomarkers. My speculative DNA interface envisions using DNA to not only store emotional data but also to synthesize hormones that correspond to specific emotions. This approach builds on research showing the potential for DNA-based systems to interact dynamically with our biology, allowing us to physically manifest and regulate emotions. This aligns with recent studies on bioorthogonal DNA circuits, which demonstrate high specificity and efficiency in tracking intracellular biomarkers, providing a foundation for creating intricate and responsive biological interfaces. <img width="3706" height="1862" width_o="3706" height_o="1862" data-src="https://freight.cargo.site/t/original/i/d52dc06fb60bd8162eb0efedf339cd44bf28684a65a0d7a5a4560184a3c64cb9/Screenshot-2025-10-06-at-4.13.24PM.png" data-mid="239089677" border="0" src="https://freight.cargo.site/w/1000/i/d52dc06fb60bd8162eb0efedf339cd44bf28684a65a0d7a5a4560184a3c64cb9/Screenshot-2025-10-06-at-4.13.24PM.png" /> Reference papers Feiyu Wang et al. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023. Yingying Chen et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021. Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly. Frontiers in Bioscience, 2022. 3. Physical Twin of Your Body The potential for DNA-based interfaces extends beyond data storage to applications such as creating physical representations of biological states. Researchers have developed DNA circuits and biosensors capable of detecting and responding to biochemical markers, paving the way for advanced health monitoring and therapeutic applications. Hybridization chain reactions (HCR) have been employed to create highly sensitive biosensors that can detect specific RNA sequences within living cells, enabling precise monitoring of physiological states. Building on this, my speculative DNA interface envisions a 'ball' made of actual DNA, proteins, and other biological components that interact in sync with the human body. Such an interface could serve as a physical twin, reflecting and responding to the body's biochemical and emotional states. This concept is supported by recent research on bioorthogonal DNA circuits, which demonstrate high specificity and efficiency in tracking intracellular biomarkers, providing a foundation for creating intricate and responsive biological interfaces. Additionally, advancements in localized hybridization chain reactions and catalytic hairpin assemblies have shown significant improvements in sensitivity and specificity, further enhancing the capabilities of DNA-based biosensors. <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/1d015066-edde-4b78-80a3-17d2c36f8b7b/3df1e54af0125da2d72eb76f252a78e5.gif"> Reference papers: Feiyu Wang et al. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023. Yingying Chen et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021. Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly. Frontiers in Bioscience, 2022. Feiyu Wang, Yiwen Xie, Weijie Zhu, Tianxiang Wei. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023. Chen, Gong, Gao et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021. Q. What’s the meaning of embedding information into the DNA from ourselves? Lab Protocol for the first aim Write your name with your DNA Write my name with DNA, and read it by sequencing the DNA A. Extract DNA from your body Protocol : 2022 DNA Extraction exercise + 2024 CRISPR exercise(Not done yet) Isolate DNA - Lab Kit Work time: 1-1.5 hours. Use a DNA extraction kit (Qiagen DNeasy® Blood &amp; Tissue Kit) Purification of total DNA from animal saliva using the DNeasy® Blood &amp; Tissue Kit, User developed protocol: https://www.qiagen.com/gb/resources/download.aspx?id=22471a48-832e-488d-8be6-2b308133b88a&amp;lang=en Note: This procedure has been adapted by customers from the DNeasy animal blood and cell protocol and is for purificatn of DNA from fresh or frozen animal saliva using the DNeasy Blood &amp; Tissue Kit. It has not been thoroughly tested and optimized by QIAGEN. IMPORTANT: Please read the “Safety Information” and “Important Notes” sections in the DNeasy Blood &amp; Tissue Handbook before beginning this procedure. For safety information on the additional chemicals mentioned in this protocol, please consult the appropriate material safety data sheets (MSDSs), available from the product supplier. DNeasy Blood &amp; Tissue Kits are intended for research use. No claim or representation is intended to provide information for the diagnosis, prevention, or treatment of a disease. Equipment and reagents to be supplied by user DNeasy Blood &amp; Tissue Kit (cat. no. 69504 or 69506) Pipets and pipet tips Vortexer Microcentrifuge tubes (1.5 ml or 2 ml) Microcentrifuge with rotor for 1.5 ml and 2 ml tubes Centrifuge capable of attaining 1800 x g with 15 ml falcon tubes Thermomixer, shaking water bath, or rocking platform for heating at 56°C Ethanol (96–100%)* PBS, pH 7.2 (50 mM potassium phosphate, 150 mM NaCl) Important points before starting If using the DNeasy Blood &amp; Tissue Kit for the first time, read “Important Notes” in the DNeasy Blood &amp; Tissue Handbook. All centrifugation steps are carried out at room temperature (15–25°C). Vortexing should be performed by pulse-vortexing for 5–10 s. PBS is required for use in steps 1 and 2. Buffer ATL is not required in this protocol. Things to do before starting Buffer AL may form precipitates upon storage. If necessary, warm to 56°C until the precipitates have fully dissolved. Buffer AW1 and Buffer AW2 are supplied as concentrates. Before using for the first time, add the appropriate amount of ethanol (96–100%) as indicated on the bottle to obtain a working solution (note: this will already have been completed by the TA). Preheat a thermomixer, shaking water bath, or rocking platform to 56°C for use in step 4. Collect your saliva sample at home before just before coming to the lab Avoid eating/drinking at least 30 minutes prior to saliva collection. Rub your tongue along your gums to ensure you slough off plenty of genetic material. Collect 1ml of saliva in your provided eppendorf tube. Clean the outside of the tube with isopropanol, place the tube in a plastic bag, and bring it with you to lab. DNA Extraction Protocol Spray the outside of your saliva tube with ethanol and wipe with a kimwipe. Carefully parafilm the sample lid to keep it closed while heating and place your sample in a 92°C heat block for 15 minutes to inactivate any possible SARS-2-CoV contamination. Change gloves. Allow to cool for 5 minutes. While the sample is cooling, add 4 ml PBS to a 15 ml falcon tube. Once cooled, add 1 ml of the heat-inactivated saliva, mix well. Transfer 2 ml sample to two 2 ml eppendorf tubes and centrifuge at 1800 x g for 5 min. Ensure centrifuge is properly balanced! Ask a TA if you have questions. Carefully decant the supernatant. Evenly divide the remaining sample among the two tubes. Centrifuge at 1800 x g for 5 min. Carefully decant the supernatant. Resuspend each of the two pellets in 90 μl PBS, mix well. Transfer both samples to a single 1.5 ml eppendorf tube. Add 25 μl proteinase K solution and 200 μl Buffer AL. Mix thoroughly by vortexing, and incubate at 56°C for 10 min. It is essential that the sample and Buffer AL are mixed immediately and thoroughly by vortexing or pipetting to yield a homogeneous solution. Add 200 μl ethanol (96–100%) to the sample and mix thoroughly by vortexing. It is important that the sample and the ethanol are mixed thoroughly to yield a homogeneous solution. Pipet the mixture from step 5 (including any precipitate) into the DNeasy Mini spin column placed in a 2 ml collection tube (provided). Centrifuge at ≥6000 x g (8000 rpm) for 1 min. Discard flow-through and collection tube. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW1, and centrifugefor 1 min at ≥6000 x g (8000 rpm). Discard flow- through and collection tube. Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW2, and centrifuge for 3 min at 20,000 x g (14,000 rpm) to dry the DNeasy membrane. Discard flow-through and collection tube. It is important to dry the membrane of the DNeasy Mini spin column, since residualmay interfere with subsequent reactions. This centrifugation step ensures that noethanol will be carried over during the following elution. Following the centrifugation step, remove the DNeasy Mini spin column carefully so that column does not come into contact with the flow-through, since this will result in ethanol. If carryover of ethanol occurs, empty the collection tube, then reuse it in centrifugation for 1 min at 20,000 x g (14,000 rpm). Place the DNeasy Mini spin column in a clean 1.5 ml eppendorf tube (not provided), and pipet 100 μl water directly onto the DNeasy membrane. Incubate at room temperature for 1 min, and then centrifuge for 1 min at ≥6000 x g (8000 rpm) to elute. This is your DNA sample! **** CAUTION: DO NOT ADD BLEACH TO FLOW-THROUGH!!! Flow-through contains Buffer AL or Buffer AW1 and is therefore not compatible with bleach. Discard flow-through in a falcon tube in the hazardous waste box. See DNeasy Blood &amp; Tissue Handbook for safety information.**** Now that I’m writing this, I thought I should have taken a selfie of me trying to spit into a tiny centrifuge tube. <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/07f67df7-3abd-46d9-ab67-3a26daf9bcd4/E2BFC187-7D98-4830-B3AE-D81DE5F10F71_1_102_o.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/49297688-d3fa-4128-afbc-9f716e1d2f0f/IMG_6111.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/27529899-9041-4e22-9556-d91381512126/IMG_6116.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/2a900de4-1985-4be1-b809-a0f1e4945eb4/3744F228-C167-4F00-AD02-8D758FD6FF5A_1_105_c.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/2d5eedc2-e4d9-43bd-9492-936ca04b4be1/IMG_6120.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/218aae6e-c2e6-4d84-9a81-a04aa604c771/18AAFA1A-FC11-487B-B721-724393F12C56_1_102_o.jpeg"> Prep - PCR <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/e558a438-782f-4d26-9f83-0494b98a49f4/E55C62F9-7A24-44C8-BADE-EF4D5E2CE47A_1_105_c.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/598ca48c-2b61-4113-b3c2-e80603de2704/7B187A5A-D5A0-4E3A-83C2-1208BD7A1D47_1_105_c.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/b83f9ad8-73e4-46f0-a988-86cd6fc626aa/A22425B8-C45B-4E51-997D-36FAB8C56915_4_5005_c.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/89e25506-782a-408c-98ca-a075871d82d0/18066AB4-5B36-4F6D-8798-D859C882C752_1_105_c.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/582043e9-2e03-4de9-a8c7-c780999430cf/F8AF5E54-C6B6-470D-8D68-CE33C05B5997_1_102_o.jpeg"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/e7e29434-0ba8-4bbe-82df-07756c142eca/AA7320C0-F9E2-41D9-B776-70BE815F347A_1_102_o.jpeg"> DNA extraction <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/38355591-01e7-418c-818e-76823edb67ed/f25a0e60-b6dd-4040-991a-e400163fa9b4.png"> DNA Sample from my saliva B. Encode your information into DNA <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/6d34d04c-c87d-4681-bc71-f57ccd508bba/b108494c-d247-4ec7-8cd9-6037053a1518.png"> It was too long to put into below 60 base pairs limits. Some chat with GPT for shortening down the length of the sequence. Eventually I orderd from IDT <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/e47e37b5-bde6-4b30-bafb-170ca7c53ca8/Screenshot_2024-05-14_at_2.59.14_PM.png"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/362966e7-3776-474c-aff1-35516d6328cf/Screenshot_2024-05-14_at_2.56.29_PM.png"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/68231c06-0c7e-4434-b607-1f5aa29aca00/Screenshot_2024-05-14_at_2.54.15_PM.png"> FInal code for encoding information in DNA / and read the information into ASCII dna1.py ascii.py WIP - using nltk to shorten the sequence dna_nltk.py Acknowledgement!! Huge thanks to TA Steven Ness! <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/0d18aa4e-1840-458d-9fa2-8d49956c53bf/Screenshot_2024-05-14_at_2.55.22_PM.png"> C. Design a Plasmid with Benchling - put your name in it! GGTGCCTCCGTGTCTGTTGTTGGT → Where should I put this? Option 1) cut puc19 / follow the protocol -&gt; gibson assembly -&gt; circular plasmid with your name Option 2) CRISPR <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/a6736ffe-95dd-432d-ba85-78e832dec0d5/Screenshot_2024-05-14_at_3.15.25_PM.png"> CRISPR Prime Editing Plasmids *Source: Originally CRISPR Lab protocol, https://www.nature.com/articles/s41467-021-25541-3#Sec22*go to the editing point cut / add a single base single-based mutation or cut. insert a big chunk Reference research material **https://www.addgene.org/browse/article/28216983/** mpubMed Full text link Supplementatary materials 41467_2021_25541_MOESM1_ESM.pdf <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/21b336fb-3f8f-4029-ad80-466fcf4ef75b/Untitled.png"> [notes from Eyal] gtcctaggtataatactagtCTTGTCACTACTCTGACCTAgttttaga gctagaaatagc modular way to do whatever you want Uppercase part -&gt; address : this part is GFP. ——&gt; CTTGTCACTACT first lower case letters —&gt; copy and search. perfect fit you can change the capital letters -&gt; they’re in the different plasmid CTTGTCACTACTCTGACCTA-&gt; GFP change the address to be something human but -&gt; what’s interesting is everything is same. you don’t touch lowercase, uppercase -&gt; edit First things -&gt; complementary to what you’re editing. CTTGTCACTACTCTGACCTA (PEgRNA_GFP) TCACTACTCTGACCTATTAAGGT GTTCAA (PEgRNA_GFP_TA Ain_R) bind to the target TCACTACTCTGACCTATTGTAGAATCAGCCCACGAAACCGAGCGGGCGAGGGTGTTCAA 99 / 90 max limit to order from idt 90 maybe try three different primers FWRD -&gt; we have somewhere for the reverse -&gt; information. edit GFP - turn off TCACTACTCTGACATATCTTTCAAAG <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/12a39aa6-d4e4-4f81-9ae0-ed74b56ca3a8/Screenshot_2024-05-14_at_3.11.23_PM.png"> [more notes] Difference of,,, Puc19 - empty container : to hold the piece of DNA. / grow it forever. pPegRNA - has something. promoter -&gt; guide RNA scaffold —&gt; put into bacteria it will produce RNA plasmids -&gt; puc19 is same without gRNAscaffold and CRISPR -&gt; turn into RNA specific shape -&gt; folds / captures protein DNA. editing. changing genome. CRISPR -&gt; find the target. RNA. inserts an edit theoratically -&gt; put into other people’s DNA inside the nucli (let’s say your cell) -&gt; it will DNA <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/4c7eda0e-00d5-4131-b3f3-ab18d71ba9d0/ccefead8-5c19-471d-bddc-2e271435502d.png"> shut off the computer CRISPR -&gt; in vivo system. it’s still working. you don’t need to open up the cell. So, Primers I need PEgRNA_GFP_F gtcctaggtataatactagtCTTGTCACTACTCTGACCTAgttttagagctagaaatagc For PCR amplification of desired PEgRNA functional cassettes. Sequences in lower case are overhangs for Gibson assembly. pVRb_PEgRNA_backbone_F TTTTTTTGAAGCTTGGGCCC For PCR amplification of plasmid pVRb_PEgRNA_backbone_R ACTAGTATTATACCTAGGACTGAGC backbone for Gibson assembly of PEgRNA. Primer_rev_FIrst_Name(based on PEgRNA_GFP_33i n_R) gggcccaagcttcaaaaaaaTCACTACTCTGACCTATGGTGCCTCCGTGTCTGTTGTTGGTGGTGTTCAAgcaccgactcggtgccactt based on PEgRNA_GFP_33i n_R, edited for embedding my name into the DNA order both PAGE / non-PAGE options Primer_rev_initial(based on PEgRNA_GFP_33i n_R) HTG_Final_Primer_rev_FirstName_PAGE Order from IDT Acknowledgement!! Huge thanks to Eyal! <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/ee6c6bf2-074b-4917-822a-7aa2687d8ed1/Order_Summary.png"> <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/7bc15465-e625-4ed4-b6a6-2f70c6f5d819/Screenshot_2024-05-14_at_3.25.01_PM.png"> [Future Lab works] Do the other half of the lab - CRISPR Transformation and Plating (Miniprep, Gibson Assembly, Transform) Culture Sequence - Acknowledgement!! Huge thanks to Evan! Helped me with initial ideation and figuring out what I need to order [notes from Evan below] Genomic DNA extraction kit (for your saliva). DNA from Twist to encode the information you want. IMPORTANT: the DNA information needs to have recognition sites for all of the restriction enzymes you’ll use (these are put at the beginning and end of the DNA sequence) Restriction enzymes (BsaI and PaqCI are common ones that are used in 2-enzyme systems). The following are required in addition to the enzymes, usually sold in a kit: PaqCI activator T4 ligase T4 ligase buffer and of course more thoughts on,,, <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/078a141e-9404-4c53-b291-db2e44920257/Untitled.png"> Highly Specific Detection of Oxytocin in Saliva Muhit Rana,1 Nimet Yildirim,1 Nancy E. Ward,2 Stephanie P. Vega,2 Michael J. Heffernan,2 and&nbsp; Avni A. Argun1,* https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10003004/ (Thanks again to Steven!) <img src="https://prod-files-secure.s3.us-west-2.amazonaws.com/56586ae4-f25f-4dde-840e-d033462ec84f/d678a29c-961e-42d8-9c9a-37d875c147b6/Untitled.png"> Small form factor DNA Sequencer https://www.ox.ac.uk/news/2015-10-15-mini-dna-sequencer’s-data-belies-its-size <img width="2654" height="1674" width_o="2654" height_o="1674" data-src="https://freight.cargo.site/t/original/i/5b8c4a875eeabb265bb20a3528fa1e01ec39abbe824d9c0120ac0f0e8b79ba2b/HTGAA_Device_thumnail.png" data-mid="239089402" border="0" src="https://freight.cargo.site/w/1000/i/5b8c4a875eeabb265bb20a3528fa1e01ec39abbe824d9c0120ac0f0e8b79ba2b/HTGAA_Device_thumnail.png" /> <img width="1307" height="1313" width_o="1307" height_o="1313" data-src="https://freight.cargo.site/t/original/i/36dc2e50915e9cac9a3b65a80a797ab81f5c3bd0d35692acec82231622e0c93c/HTGAA_Thumnail.png" data-mid="239089261" border="0" data-scale="84" src="https://freight.cargo.site/w/1000/i/36dc2e50915e9cac9a3b65a80a797ab81f5c3bd0d35692acec82231622e0c93c/HTGAA_Thumnail.png" /> https://kimkeunwook.com/HTMAA-Week1-Computer-Aided-Design-1 Fri, 22 Dec 2023 10:09:52 +0000 kimkeunwook https://kimkeunwook.com/HTMAA-Week1-Computer-Aided-Design-1 ︎ Home Week1Computer-Aided Design Designing ‘Printed Circuit Box’, not a ‘Printed Circuit Board’One side had to be open for xiao board access, and other three work as capacitive sensing pads. One work as base connection for xiao, and also routes for capacitive sensing are there. The last panel consist of 10 LEDs, which are percievable from the both sides of the glass.&nbsp; <img width="2530" height="1926" width_o="2530" height_o="1926" data-src="https://freight.cargo.site/t/original/i/00ca3ab77830ca8e55ee8ce9ad847cde0dcffadcdb105b9ac415d2a02b8aac34/Screenshot-2023-12-22-at-2.46.45-AM.png" data-mid="199983377" border="0" src="https://freight.cargo.site/w/1000/i/00ca3ab77830ca8e55ee8ce9ad847cde0dcffadcdb105b9ac415d2a02b8aac34/Screenshot-2023-12-22-at-2.46.45-AM.png" /> 2D Flat layout - Does it look too decorative? They will be clear so it doesn’t matter. <img width="2538" height="1948" width_o="2538" height_o="1948" data-src="https://freight.cargo.site/t/original/i/cacffd0f1409798672b19a9cf958f32d3fc67b9086c7c311d59bcdc8fc27a959/Screenshot-2023-12-22-at-1.11.10-AM.png" data-mid="199983378" border="0" src="https://freight.cargo.site/w/1000/i/cacffd0f1409798672b19a9cf958f32d3fc67b9086c7c311d59bcdc8fc27a959/Screenshot-2023-12-22-at-1.11.10-AM.png" /> Making surfaces out of the lines <img width="2536" height="1690" width_o="2536" height_o="1690" data-src="https://freight.cargo.site/t/original/i/03c71d0bd45e48da7786ce7a20691d3c9e772ac1b87411f4ca5f7412e40ad5ce/Screenshot-2023-12-22-at-3.46.44-AM.png" data-mid="199983392" border="0" src="https://freight.cargo.site/w/1000/i/03c71d0bd45e48da7786ce7a20691d3c9e772ac1b87411f4ca5f7412e40ad5ce/Screenshot-2023-12-22-at-3.46.44-AM.png" />Surfaces connected as a cube &nbsp; &nbsp; <img width="4112" height="2658" width_o="4112" height_o="2658" data-src="https://freight.cargo.site/t/original/i/80099da75f73ccb09b87a47aa91b3355fb65a95efbd937ab5cc5b0119652d8b1/Screenshot-2023-12-22-at-1.15.48-AM.png" data-mid="199983393" border="0" src="https://freight.cargo.site/w/1000/i/80099da75f73ccb09b87a47aa91b3355fb65a95efbd937ab5cc5b0119652d8b1/Screenshot-2023-12-22-at-1.15.48-AM.png" /> importing Xiao STEP model <img width="2556" height="1952" width_o="2556" height_o="1952" data-src="https://freight.cargo.site/t/original/i/1615afd94c78bd213e9bd2788534813b89f948e8be4f7ca2e25991ed7b0ed2f6/Screenshot-2023-12-22-at-1.18.11-AM.png" data-mid="199983394" border="0" src="https://freight.cargo.site/w/1000/i/1615afd94c78bd213e9bd2788534813b89f948e8be4f7ca2e25991ed7b0ed2f6/Screenshot-2023-12-22-at-1.18.11-AM.png" />‘Insert’ the model <img width="2548" height="1952" width_o="2548" height_o="1952" data-src="https://freight.cargo.site/t/original/i/3d37317bac2531b5d65823f4847dc68f32989f50e12c06064b8ac17b3ce26e02/Screenshot-2023-12-22-at-1.18.34-AM.png" data-mid="199983395" border="0" src="https://freight.cargo.site/w/1000/i/3d37317bac2531b5d65823f4847dc68f32989f50e12c06064b8ac17b3ce26e02/Screenshot-2023-12-22-at-1.18.34-AM.png" />Adjust the orientation <img width="2534" height="1928" width_o="2534" height_o="1928" data-src="https://freight.cargo.site/t/original/i/5e36bf8000978fd7e8267d47c9fc624ce3538458160e232031f91a7d7a254647/Screenshot-2023-12-22-at-1.20.24-AM.png" data-mid="199983399" border="0" src="https://freight.cargo.site/w/1000/i/5e36bf8000978fd7e8267d47c9fc624ce3538458160e232031f91a7d7a254647/Screenshot-2023-12-22-at-1.20.24-AM.png" /> Finished 3D layout <img width="2530" height="1944" width_o="2530" height_o="1944" data-src="https://freight.cargo.site/t/original/i/9df8d648d9face3c5dbc54e8cced75799735f3e16e138c760429a74074995570/Screenshot-2023-12-22-at-1.53.19-AM.png" data-mid="199983397" border="0" src="https://freight.cargo.site/w/1000/i/9df8d648d9face3c5dbc54e8cced75799735f3e16e138c760429a74074995570/Screenshot-2023-12-22-at-1.53.19-AM.png" />Adding battery and switch - all measured with calipers <img width="2548" height="1954" width_o="2548" height_o="1954" data-src="https://freight.cargo.site/t/original/i/d907644c9b75320a479e1b5ff647b4ddc57732f05cb4400e90ea4d31504353ba/Screenshot-2023-12-22-at-1.57.52-AM.png" data-mid="199983398" border="0" src="https://freight.cargo.site/w/1000/i/d907644c9b75320a479e1b5ff647b4ddc57732f05cb4400e90ea4d31504353ba/Screenshot-2023-12-22-at-1.57.52-AM.png" />Adding LEDs <img width="2542" height="1948" width_o="2542" height_o="1948" data-src="https://freight.cargo.site/t/original/i/6b0b9bc16b3ce4fc581282b91af690fb2ba3e1192a6138c00656c1cb89c30f67/Screenshot-2023-12-22-at-2.01.16-AM.png" data-mid="199983372" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/6b0b9bc16b3ce4fc581282b91af690fb2ba3e1192a6138c00656c1cb89c30f67/Screenshot-2023-12-22-at-2.01.16-AM.png" /> <img width="2538" height="1942" width_o="2538" height_o="1942" data-src="https://freight.cargo.site/t/original/i/3a02255d14899573548c925aabf86b7c15a2426b252566e9d98ec8449a3eb8b9/Screenshot-2023-12-22-at-2.01.30-AM.png" data-mid="199983373" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/3a02255d14899573548c925aabf86b7c15a2426b252566e9d98ec8449a3eb8b9/Screenshot-2023-12-22-at-2.01.30-AM.png" /> Renders in Rhino are not really recommendable - moving on to Keyshot for a better visualization [Visualization] [Outcome] <img width="3840" height="2400" width_o="3840" height_o="2400" data-src="https://freight.cargo.site/t/original/i/e678d5631660b77d68a2c8164672e9b318e3edc08a312de84ae3d7b2faf9b778/Render_transparentPCB.png" data-mid="199983374" border="0" src="https://freight.cargo.site/w/1000/i/e678d5631660b77d68a2c8164672e9b318e3edc08a312de84ae3d7b2faf9b778/Render_transparentPCB.png" /> [Render Process - Keyshot] <img width="3892" height="2228" width_o="3892" height_o="2228" data-src="https://freight.cargo.site/t/original/i/bb8c00c22a11f3d260da1ce83014f39c39f837716069173027c5df68117d13d4/Screenshot-2023-12-22-at-2.10.57-AM.png" data-mid="199983401" border="0" src="https://freight.cargo.site/w/1000/i/bb8c00c22a11f3d260da1ce83014f39c39f837716069173027c5df68117d13d4/Screenshot-2023-12-22-at-2.10.57-AM.png" />Import the Rhino model directly using Rhino-Keyshot plugin. As the material is not assigned, everything is black or white or other colors based on the rhino render material setting. <img width="3896" height="2238" width_o="3896" height_o="2238" data-src="https://freight.cargo.site/t/original/i/9f0f6813c931d88ec5dfcc142241d07eddc496b80d6cb160c710966e4a08c584/Screenshot-2023-12-22-at-2.12.32-AM.png" data-mid="199983402" border="0" src="https://freight.cargo.site/w/1000/i/9f0f6813c931d88ec5dfcc142241d07eddc496b80d6cb160c710966e4a08c584/Screenshot-2023-12-22-at-2.12.32-AM.png" />Change the material from plastic to glass(solid) <img width="2576" height="1596" width_o="2576" height_o="1596" data-src="https://freight.cargo.site/t/original/i/98d7b6f9401907278f6b592d8937af98310ab20902335262eeadbe8d2030fdc8/Screenshot-2023-12-22-at-2.18.03-AM.png" data-mid="199983404" border="0" src="https://freight.cargo.site/w/1000/i/98d7b6f9401907278f6b592d8937af98310ab20902335262eeadbe8d2030fdc8/Screenshot-2023-12-22-at-2.18.03-AM.png" />When you import a STEP file or Solidworks file in Rhino, it’s unlikely they are divided into layers by material. The materials should be unliked first to be assigend for right ones. <img width="2536" height="1594" width_o="2536" height_o="1594" data-src="https://freight.cargo.site/t/original/i/f75918b5248dce2322fd8fcf2cc49c12b2fdf51456332eab26a6353cdb881df7/Screenshot-2023-12-22-at-2.22.26-AM.png" data-mid="199983405" border="0" src="https://freight.cargo.site/w/1000/i/f75918b5248dce2322fd8fcf2cc49c12b2fdf51456332eab26a6353cdb881df7/Screenshot-2023-12-22-at-2.22.26-AM.png" />You can set the right material to the model after several commands such as Ungroup / Explode / assigning material&nbsp; <img width="3890" height="2242" width_o="3890" height_o="2242" data-src="https://freight.cargo.site/t/original/i/7a92272c89b07f6e5de7474426d34a9fc82384dd5518d5d57d772267571f289c/Screenshot-2023-12-22-at-2.24.27-AM.png" data-mid="199983407" border="0" src="https://freight.cargo.site/w/1000/i/7a92272c89b07f6e5de7474426d34a9fc82384dd5518d5d57d772267571f289c/Screenshot-2023-12-22-at-2.24.27-AM.png" />For clear / transparent material, the reflection, texture, and what is behind the object matter. <img width="4112" height="2658" width_o="4112" height_o="2658" data-src="https://freight.cargo.site/t/original/i/eee82ff61129c1492789ebb7875e1667e3badd469a5acb7c34e24dff904387e2/Screenshot-2023-12-22-at-2.28.09-AM.png" data-mid="199983408" border="0" src="https://freight.cargo.site/w/1000/i/eee82ff61129c1492789ebb7875e1667e3badd469a5acb7c34e24dff904387e2/Screenshot-2023-12-22-at-2.28.09-AM.png" /> FInally, after assigning lights with emissive and changing the background color, render the final image. [Process - CAD] <img width="3648" height="2262" width_o="3648" height_o="2262" data-src="https://freight.cargo.site/t/original/i/afe0662efe02139dab7d75b7147176135fd0b245431bff430903847b8e1d9331/Screenshot-2023-12-22-at-2.05.11-AM.png" data-mid="199983400" border="0" src="https://freight.cargo.site/w/1000/i/afe0662efe02139dab7d75b7147176135fd0b245431bff430903847b8e1d9331/Screenshot-2023-12-22-at-2.05.11-AM.png" /> Hundreds of iterations are inevitable to make a working prototype https://kimkeunwook.com/HTMAA-Week2-Computer-Controlled-Cutting Wed, 20 Sep 2023 15:10:24 +0000 kimkeunwook https://kimkeunwook.com/HTMAA-Week2-Computer-Controlled-Cutting ︎ Home Week2 Computer-Controlled Cutting Output A : Clone of my Custom mini-ITX PC (Computer-1 by Teenage Engineering) <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/f461749e2938a91fe56a6f3d2d68a50fef489f915e31fca3e191d842812220b8/IMG_9020.jpeg" data-mid="191382418" border="0" src="https://freight.cargo.site/w/1000/i/f461749e2938a91fe56a6f3d2d68a50fef489f915e31fca3e191d842812220b8/IMG_9020.jpeg" /> Why? <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/e064868e77fd6500887019cec9ec2f9b4738ec4153f21b973a7b3a4dfddcdf0f/IMG_8839.jpeg" data-mid="191383241" border="0" data-scale="47" src="https://freight.cargo.site/w/1000/i/e064868e77fd6500887019cec9ec2f9b4738ec4153f21b973a7b3a4dfddcdf0f/IMG_8839.jpeg" />I bought a mini-itx computer case designed by Teenage Engineering (Computer1). Although it looks nice, It was very hard to assemble it. That brought me here to test if this could be made with cardboard. Process: CAD -&gt; Laser Cut -&gt; Vynl cut -&gt; Assembly 1. CAD: Clone the PC case based on the picture or dimensions on the website <img width="3844" height="2512" width_o="3844" height_o="2512" data-src="https://freight.cargo.site/t/original/i/1d8794b6c83d254c567cb412cc5c16f626c9a543bf527a0fc1001502846eca43/Screenshot-2023-09-19-at-4.43.50-PM.png" data-mid="191382562" border="0" src="https://freight.cargo.site/w/1000/i/1d8794b6c83d254c567cb412cc5c16f626c9a543bf527a0fc1001502846eca43/Screenshot-2023-09-19-at-4.43.50-PM.png" /> 2. Lasercut: Export the AI file and put it into the computer linked to the Fusion Pro&nbsp; <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/e72d7d18310774623ebd438f40acd9b696ff549bffd808a7f0c26d1855bf20f0/IMG_8934.jpeg" data-mid="191382663" border="0" src="https://freight.cargo.site/w/1000/i/e72d7d18310774623ebd438f40acd9b696ff549bffd808a7f0c26d1855bf20f0/IMG_8934.jpeg" />Having a camera on a Laser cutter is nice - I’ve never used one with a camera before. <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/9b1a919a9d39d2ff9dbd1f993f1d3f62d1ee099b57c8ee3c8d4f3e241ae2246a/IMG_8936.jpeg" data-mid="191382948" border="0" data-scale="35" src="https://freight.cargo.site/w/1000/i/9b1a919a9d39d2ff9dbd1f993f1d3f62d1ee099b57c8ee3c8d4f3e241ae2246a/IMG_8936.jpeg" />&nbsp; See the running time? It took 30 mins to finish - because <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/2d81e7f8b021336efca9251c5f4ff8b2d758f8f8c7f39bdc25748bd7e813e7a8/IMG_8937.jpeg" data-mid="191382509" border="0" src="https://freight.cargo.site/w/1000/i/2d81e7f8b021336efca9251c5f4ff8b2d758f8f8c7f39bdc25748bd7e813e7a8/IMG_8937.jpeg" /> There are a lot of holes, and these holes take a lot of time to finish. 3. Assembly: I assembled it with wood screws - as the original PC case is assembled with screws. <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/67f9fd69258ee5f7388197d0d89894befedd87da1fd6dd6f15dcb7ada4e65fe2/IMG_9005.jpeg" data-mid="191384858" border="0" data-scale="36" src="https://freight.cargo.site/w/1000/i/67f9fd69258ee5f7388197d0d89894befedd87da1fd6dd6f15dcb7ada4e65fe2/IMG_9005.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/5e71dd556e3f9552529edc64aa4bbd6a1c99f92725810e215242992904b98893/IMG_9008.jpeg" data-mid="191385020" border="0" data-scale="36" src="https://freight.cargo.site/w/1000/i/5e71dd556e3f9552529edc64aa4bbd6a1c99f92725810e215242992904b98893/IMG_9008.jpeg" /> <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/70b92a788535fb22bbe42d9379e80de8e9dddd2c71d22e518105ee6c45d5f9b4/IMG_9007.jpeg" data-mid="191384855" border="0" data-scale="28" src="https://freight.cargo.site/w/1000/i/70b92a788535fb22bbe42d9379e80de8e9dddd2c71d22e518105ee6c45d5f9b4/IMG_9007.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/43564be24b1bb4c4e555a26e3ec8f84b807f669912772d9a5653bf49e38c5134/IMG_9014.jpeg" data-mid="191385718" border="0" data-scale="55" src="https://freight.cargo.site/w/1000/i/43564be24b1bb4c4e555a26e3ec8f84b807f669912772d9a5653bf49e38c5134/IMG_9014.jpeg" /> And then I thought it would be nice to put a sticker on the logo as the restered part was barely visible. <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/55464579f55da12890d7b2d4ed8a5931b46a72a0e702462da7e39a7e573c390c/IMG_9040.jpeg" data-mid="191399094" border="0" src="https://freight.cargo.site/w/1000/i/55464579f55da12890d7b2d4ed8a5931b46a72a0e702462da7e39a7e573c390c/IMG_9040.jpeg" />I changed the logo - from T+O(bolts and nuts representing ‘teenage engineering’ to C + O ( half nut and a nut) representing ‘cardboard engineering) By the way, the size difference is because of the distance - the cardboard one is behind the aluminum one. <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/1463db0e0596e9c9e95d750c6f009fdbdc92937eddfb4a77db9062b7d14254bd/IMG_9039.jpeg" data-mid="191386489" border="0" data-scale="49" src="https://freight.cargo.site/w/1000/i/1463db0e0596e9c9e95d750c6f009fdbdc92937eddfb4a77db9062b7d14254bd/IMG_9039.jpeg" /><img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/2198c39f893e1b098b03af9714a8c82a3722bc1c756f6cb4cac4b6066660d05f/IMG_9026.jpeg" data-mid="191386326" border="0" data-scale="50" src="https://freight.cargo.site/w/1000/i/2198c39f893e1b098b03af9714a8c82a3722bc1c756f6cb4cac4b6066660d05f/IMG_9026.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/414b194d2ee4a0d12583572c212af8d8eda8a7c9122a65ede1cdeddf751aaab9/IMG_9028.jpeg" data-mid="191386331" border="0" data-scale="40" src="https://freight.cargo.site/w/1000/i/414b194d2ee4a0d12583572c212af8d8eda8a7c9122a65ede1cdeddf751aaab9/IMG_9028.jpeg" /><img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/80077414d71f7193316746bd4eae0dfc9b7386c200b80482cd986a70c51dd868/IMG_9027.jpeg" data-mid="191386328" border="0" data-scale="57" src="https://freight.cargo.site/w/1000/i/80077414d71f7193316746bd4eae0dfc9b7386c200b80482cd986a70c51dd868/IMG_9027.jpeg" /> Output B: Testing conductive foil tape with Vynl cutter <img width="1952" height="1430" width_o="1952" height_o="1430" data-src="https://freight.cargo.site/t/original/i/e5116d79602cda82cbf3a4b4c9f4427f773700222b84dd620ae7ba415172347c/Screenshot-2023-09-20-at-11.31.05-AM.png" data-mid="191386740" border="0" data-scale="69" src="https://freight.cargo.site/w/1000/i/e5116d79602cda82cbf3a4b4c9f4427f773700222b84dd620ae7ba415172347c/Screenshot-2023-09-20-at-11.31.05-AM.png" /> For the final project, I wanted to test if I could cut conductive foil tape with Vynl Cutter.&nbsp; So, the shape is intended to test the limits of the material. <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/66125239f2ba331866fd223b23a49e2d71d197aa53054194e860756ceaf1b3cc/IMG_8939.jpeg" data-mid="191386493" border="0" data-scale="48" src="https://freight.cargo.site/w/1000/i/66125239f2ba331866fd223b23a49e2d71d197aa53054194e860756ceaf1b3cc/IMG_8939.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/08fdccc89c95c4420db1dce821f6a13666d239e8097e2e6cc3b9b0f490105eeb/IMG_8949.jpeg" data-mid="191386719" border="0" data-scale="47" src="https://freight.cargo.site/w/1000/i/08fdccc89c95c4420db1dce821f6a13666d239e8097e2e6cc3b9b0f490105eeb/IMG_8949.jpeg" />Prepare the foil and attach it to the pad. <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/219038ba518487261b397046f06fca1f33041d47044f666b7cf83435786940cd/IMG_8944.jpeg" data-mid="191386877" border="0" data-scale="44" src="https://freight.cargo.site/w/1000/i/219038ba518487261b397046f06fca1f33041d47044f666b7cf83435786940cd/IMG_8944.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/b87873c0ab3ec07a63f3308d65f26ebe7c14ff753f4bb3e88e2868149d2a687d/IMG_8946.jpeg" data-mid="191386879" border="0" data-scale="44" src="https://freight.cargo.site/w/1000/i/b87873c0ab3ec07a63f3308d65f26ebe7c14ff753f4bb3e88e2868149d2a687d/IMG_8946.jpeg" /> Select the right material setting and check the blade if needed. <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/5602978e03c14a875c39f65e55f5945e61b43ed73f4911b6d5f6375fcef68774/IMG_8953.jpeg" data-mid="191387028" border="0" data-scale="37" src="https://freight.cargo.site/w/1000/i/5602978e03c14a875c39f65e55f5945e61b43ed73f4911b6d5f6375fcef68774/IMG_8953.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/21c2a3fbfd4c295bea5f66bdc3d0de8defdf52627639f167de3cac6aacdb6268/IMG_8956.jpeg" data-mid="191387049" border="0" data-scale="53" src="https://freight.cargo.site/w/1000/i/21c2a3fbfd4c295bea5f66bdc3d0de8defdf52627639f167de3cac6aacdb6268/IMG_8956.jpeg" /> Failed - maybe the blade gone too deep? <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/d3ef48cdc9e7f6a383ca820e174fa8f790b0641418f8cfa1185e628474eb15ee/IMG_8963.jpeg" data-mid="191387172" border="0" data-scale="41" src="https://freight.cargo.site/w/1000/i/d3ef48cdc9e7f6a383ca820e174fa8f790b0641418f8cfa1185e628474eb15ee/IMG_8963.jpeg" /><img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/9981957f0fc86178f5429f9dda7931cee43fb5452f7f587bc08df4225e3bac84/IMG_8965.jpeg" data-mid="191387183" border="0" data-scale="42" src="https://freight.cargo.site/w/1000/i/9981957f0fc86178f5429f9dda7931cee43fb5452f7f587bc08df4225e3bac84/IMG_8965.jpeg" /> Nicly done! put the transfer tape on it <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/3eaa35147c2139271f14af5cb45a9373f815a143effbbd970f2d292027169e04/IMG_8968.jpeg" data-mid="191387316" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/3eaa35147c2139271f14af5cb45a9373f815a143effbbd970f2d292027169e04/IMG_8968.jpeg" />&nbsp; <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/e28e3a80096abd9c0a7bcc6fb6555439db935ba77d55d7646ab6f591b48cc280/IMG_8969.jpeg" data-mid="191387433" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/e28e3a80096abd9c0a7bcc6fb6555439db935ba77d55d7646ab6f591b48cc280/IMG_8969.jpeg" /> Who said this is meditative? ;-) <img width="2146" height="826" width_o="2146" height_o="826" data-src="https://freight.cargo.site/t/original/i/d1941fab34d338a926c22949f987316c8a555b86804c245308dbdc8ff500ae89/Screenshot-2023-09-20-at-1.21.31-PM.png" data-mid="191397423" border="0" src="https://freight.cargo.site/w/1000/i/d1941fab34d338a926c22949f987316c8a555b86804c245308dbdc8ff500ae89/Screenshot-2023-09-20-at-1.21.31-PM.png" /> Also, Eventually, it failed because the foil was attached too tight to the transfer tape and did not come off to the acrylic plate. <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/062f0dbb0403dac92648b35af28752b39b39d5afb167a37d70b2f88d23addfcd/IMG_8978.jpeg" data-mid="191387485" border="0" data-scale="47" src="https://freight.cargo.site/w/1000/i/062f0dbb0403dac92648b35af28752b39b39d5afb167a37d70b2f88d23addfcd/IMG_8978.jpeg" /><img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/b3a0933659ade61725888f21ca3132d7c7eaa0f9fd149d4848183160d8f2de97/IMG_8986.jpeg" data-mid="191387490" border="0" data-scale="46" src="https://freight.cargo.site/w/1000/i/b3a0933659ade61725888f21ca3132d7c7eaa0f9fd149d4848183160d8f2de97/IMG_8986.jpeg" /> EE testing - connected a LED but didn’t work <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/af3c2815fca5293819bd1e82fd6903dab46178b79106c33de0b32fce6eb636b5/IMG_8995.jpeg" data-mid="191387701" border="0" data-scale="46" src="https://freight.cargo.site/w/1000/i/af3c2815fca5293819bd1e82fd6903dab46178b79106c33de0b32fce6eb636b5/IMG_8995.jpeg" /> Turned out that I connected + to - . It works. https://kimkeunwook.com/HTMAA-Week3-Embedded-Programming Wed, 27 Sep 2023 16:49:59 +0000 kimkeunwook https://kimkeunwook.com/HTMAA-Week3-Embedded-Programming ︎ Home Week3 Embedded Programming Using Conductive sensing as a low fedility EMG sensor <img src="https://encrypted-tbn2.gstatic.com/shopping?q=tbn:ANd9GcTIwojLyJozYFalBmhGQWIjWFlrIqP_aNuLa9Zy8-jT8fX49LJypupazozyGvnHoiP5Rz5ge6AP&amp;usqp=CAE"><img width="786" height="614" width_o="786" height_o="614" data-src="https://freight.cargo.site/t/original/i/55dc484a7dea74717c20da11eac25784d21e3fdfa7cb5e3a73136bb31afbc757/myo-armband-2.png" data-mid="197555759" border="0" src="https://freight.cargo.site/w/786/i/55dc484a7dea74717c20da11eac25784d21e3fdfa7cb5e3a73136bb31afbc757/myo-armband-2.png" /> For a long time, I’ve been interetsed in how humans interact with technology with hands. In that context, I got into ‘EMG’ sensors, and tried bunch of products in the market. The most well-known product would be ‘MYO band’, they are discontinued after they are acquired by the big techs like Google and Meta.&nbsp; Since my purpose of taking this coures is to learn what I usually got help from engineers friends or outsourced to factories, I decided to make an EMG sensor. Starting with, testing the sensor I have! I originally tried to test the example code with all the set up, but when I asked Quentin, he said we can just use the pads as capacitive sensors without the PCB it’s connected to. <img width="2138" height="1198" width_o="2138" height_o="1198" data-src="https://freight.cargo.site/t/original/i/c21a023d32c0e8502962a10b24e6caadb8046645ebec0b32ae343c23c95fbedc/Screenshot-2023-11-21-at-6.41.06-PM.png" data-mid="197555554" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/c21a023d32c0e8502962a10b24e6caadb8046645ebec0b32ae343c23c95fbedc/Screenshot-2023-11-21-at-6.41.06-PM.png" /> <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/41ff0a69ca79d74fd8a24da466451132974936bd675a60edc7105ba69d255ea9/IMG_1458.jpeg" data-mid="197555473" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/41ff0a69ca79d74fd8a24da466451132974936bd675a60edc7105ba69d255ea9/IMG_1458.jpeg" /> <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/2982058f78e4030763d8061f20b8ef6ecd11a084d8e31cc46dfb9ed24bb0f7ad/IMG_1462.jpeg" data-mid="199933463" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/2982058f78e4030763d8061f20b8ef6ecd11a084d8e31cc46dfb9ed24bb0f7ad/IMG_1462.jpeg" /> Checking which pads are connected to which part of the connector and mapping them. Connecting headers to Xiao SMD21 and finding out <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/10b3ccb99b0de6763c517a71f246a398eab1b31c92e37d83cb8fc451945b64d7/IMG_1468.jpeg" data-mid="197555482" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/10b3ccb99b0de6763c517a71f246a398eab1b31c92e37d83cb8fc451945b64d7/IMG_1468.jpeg" /> Quentin soldering jumperwires to the EMG sensing pads <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/45d50f165ac0167796eb8acf1f645b088b8a73974b43fb7e99669a2d1fa954a8/IMG_1476.jpeg" data-mid="199933523" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/45d50f165ac0167796eb8acf1f645b088b8a73974b43fb7e99669a2d1fa954a8/IMG_1476.jpeg" /> Fing out what pins are defined as what - I honestly don’t understand why it is always confusing to match physical pins with code pins when using Xiao&nbsp; <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/8ed02d16e7175c26bc6d8958fd90f05ed0ea242662be4945fe48b91264737aa1/IMG_1474.jpeg" data-mid="199933521" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/8ed02d16e7175c26bc6d8958fd90f05ed0ea242662be4945fe48b91264737aa1/IMG_1474.jpeg" /> <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/55cadd6420c9034682a47f92e0028db31df3bd9f5ba722810de395361df46075/IMG_1478.jpeg" data-mid="199933712" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/55cadd6420c9034682a47f92e0028db31df3bd9f5ba722810de395361df46075/IMG_1478.jpeg" /> Finally we found what pins are defined as what! We use A05, 07, 09 <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/eb1fd2c7bfee630c83e00f1a66a103ed6b31fc285401574eedf4fc3439f11efe/IMG_1479.jpeg" data-mid="199933776" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/eb1fd2c7bfee630c83e00f1a66a103ed6b31fc285401574eedf4fc3439f11efe/IMG_1479.jpeg" /> Connecting the pins with jumper wires <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/734feae9f89959562295e1707158a27d39c46d3cad505f44c9550e7e6a32ba0b/IMG_1480.jpeg" data-mid="199933751" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/734feae9f89959562295e1707158a27d39c46d3cad505f44c9550e7e6a32ba0b/IMG_1480.jpeg" /> Using Arduino Core Fab -Sam library by Quentin <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/7c5dae27bc53b694a5b3c54df5898382c1becb73c10fc577816e5587d3a310aa/IMG_1497.jpeg" data-mid="199934216" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/7c5dae27bc53b694a5b3c54df5898382c1becb73c10fc577816e5587d3a310aa/IMG_1497.jpeg" /> Re checking the pin number <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/263205743700db91c32db5f1789fd7dd99de2c593c96a0f08e1d2113c755aca3/IMG_1498.jpeg" data-mid="199934219" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/263205743700db91c32db5f1789fd7dd99de2c593c96a0f08e1d2113c755aca3/IMG_1498.jpeg" />Using Adafruit Freetouch - only available to SAMD Xiaos <img width="3024" height="4032" width_o="3024" height_o="4032" data-src="https://freight.cargo.site/t/original/i/b886a781e14cac82d61f1ebf7683b33c5add38af37e3718f93b86d90228f4aa4/IMG_1506.jpeg" data-mid="199934239" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/b886a781e14cac82d61f1ebf7683b33c5add38af37e3718f93b86d90228f4aa4/IMG_1506.jpeg" />I asked about what to do if I want to differentiate Rock, Scissors, and Paper - Quentin told me to use Voronoi&nbsp; <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/9bcf3961c10aa3298ae225deb731f6f83ade2d86f784c7f33b791b0e19971f86/IMG_1508.jpeg" data-mid="199934290" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/9bcf3961c10aa3298ae225deb731f6f83ade2d86f784c7f33b791b0e19971f86/IMG_1508.jpeg" /> Testing if it differentiate fully open hand <img width="4032" height="3024" width_o="4032" height_o="3024" data-src="https://freight.cargo.site/t/original/i/0b647a5f60f83794eec924cb35e70daf804fdfc9a38c61df5aecaf0cab351e1a/IMG_1509.jpeg" data-mid="199934292" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/0b647a5f60f83794eec924cb35e70daf804fdfc9a38c61df5aecaf0cab351e1a/IMG_1509.jpeg" /> with other gestures like folding two fingers It definitely works well telling the difference between open and closed hands