DNA Interface :
Write your name with your DNA

THIS PAGE WILL BE UPDATED SOON
- PLEASE CHECK OUT THE NOTION PAGE UNTIL THEN (CLICK)

DNA Interface - Three phases of DNA Interfaces

1. Write your name with your DNA
2. Hold your Emotion - What’s the physical form of emotion?
3. Physical Twin of your body - What if we have a ‘ball’ made of actual DNA, protein, and everything we have interacting in sync with our actual body?

1. Write Your Name with Your DNA

1. Gourab Chatterjee, Neil Dalchau, Richard A. Muscat, Andrew Phillips, Georg Seelig. "A spatially localized architecture for fast and modular DNA computing." Nature Nanotechnology, 2017.
2. Matthew R. Lakin, Andrew Phillips. "A strand graph semantics for DNA-based computation." Theoretical Computer Science, 2016.
3. Neil Dalchau, Niall Murphy, Rasmus Petersen, Boyan Yordanov. "Synthesizing and tuning chemical reaction networks with specified behaviours." International Conference on DNA Computing and Molecular Programming, 2015.

2. Hold Your Emotion - What’s the Physical Form of Emotion?

1. Feiyu Wang et al. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023.
2. Yingying Chen et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021.
3. Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly. Frontiers in Bioscience, 2022.

3. Physical Twin of Your Body

1. Feiyu Wang et al. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023.
2. Yingying Chen et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021.
3. Recent progress in the development of DNA-based biosensors integrated with hybridization chain reaction or catalytic hairpin assembly. Frontiers in Bioscience, 2022.
4. Feiyu Wang, Yiwen Xie, Weijie Zhu, Tianxiang Wei. "Recent Advances in Functionalization Strategies for Biosensor Interfaces." Chemosensors, 2023.
5. Chen, Gong, Gao et al. "Bioorthogonal regulation of DNA circuits for smart intracellular microRNA imaging." Chemical Science, 2021.

Lab Protocol for the first aim

• Write your name with your DNA
• Write my name with DNA, and read it by sequencing the DNA

A. Extract DNA from your body

Isolate DNA - Lab Kit

• DNeasy Blood & Tissue Kit (cat. no. 69504 or 69506)
• Pipets and pipet tips
• Vortexer
• Microcentrifuge tubes (1.5 ml or 2 ml)
• Microcentrifuge with rotor for 1.5 ml and 2 ml tubes
• Centrifuge capable of attaining 1800 x g with 15 ml falcon tubes
• Thermomixer, shaking water bath, or rocking platform for heating at 56°C
• Ethanol (96–100%)*
• PBS, pH 7.2 (50 mM potassium phosphate, 150 mM NaCl)

• If using the DNeasy Blood & Tissue Kit for the first time, read “Important Notes” in the DNeasy Blood & Tissue Handbook.
• All centrifugation steps are carried out at room temperature (15–25°C).
• Vortexing should be performed by pulse-vortexing for 5–10 s.
• PBS is required for use in steps 1 and 2. Buffer ATL is not required in this protocol.

• Buffer AL may form precipitates upon storage. If necessary, warm to 56°C until the precipitates have fully dissolved.
• Buffer AW1 and Buffer AW2 are supplied as concentrates. Before using for the first time, add the appropriate amount of ethanol (96–100%) as indicated on the bottle to obtain a working solution (note: this will already have been completed by the TA).
• Preheat a thermomixer, shaking water bath, or rocking platform to 56°C for use in step 4.

1. Avoid eating/drinking at least 30 minutes prior to saliva collection.
2. Rub your tongue along your gums to ensure you slough off plenty of genetic material.
3. Collect 1ml of saliva in your provided eppendorf tube. Clean the outside of the tube with isopropanol, place the tube in a plastic bag, and bring it with you to lab.

1. 
   Spray the outside of your saliva tube with ethanol and wipe with a kimwipe. Carefully parafilm the sample lid to keep it closed while heating and place your sample in a 92°C heat block for 15 minutes to inactivate any possible SARS-2-CoV contamination. Change gloves. Allow to cool for 5 minutes.
   
2. 
   While the sample is cooling, add 4 ml PBS to a 15 ml falcon tube. Once cooled, add 1 ml of the heat-inactivated saliva, mix well. Transfer 2 ml sample to two 2 ml eppendorf tubes and centrifuge at 1800 x g for 5 min.
   
   Ensure centrifuge is properly balanced! Ask a TA if you have questions.
   
3. 
   Carefully decant the supernatant. Evenly divide the remaining sample among the two tubes. Centrifuge at 1800 x g for 5 min.
   
4. 
   Carefully decant the supernatant. Resuspend each of the two pellets in 90 μl PBS, mix well. Transfer both samples to a single 1.5 ml eppendorf tube.
   
5. 
   Add 25 μl proteinase K solution and 200 μl Buffer AL. Mix thoroughly by vortexing, and incubate at 56°C for 10 min.
   
   It is essential that the sample and Buffer AL are mixed immediately and thoroughly by vortexing or pipetting to yield a homogeneous solution.
   
6. 
   Add 200 μl ethanol (96–100%) to the sample and mix thoroughly by vortexing. It is important that the sample and the ethanol are mixed thoroughly to yield a homogeneous solution.
   
7. 
   Pipet the mixture from step 5 (including any precipitate) into the DNeasy Mini spin column placed in a 2 ml collection tube (provided). Centrifuge at ≥6000 x g (8000 rpm) for 1 min. Discard flow-through and collection tube.
   
8. 
   Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW1, and centrifugefor 1 min at ≥6000 x g (8000 rpm). Discard flow- through and collection tube.
   
9. 
   Place the DNeasy Mini spin column in a new 2 ml collection tube (provided), add 500 μl Buffer AW2, and centrifuge for 3 min at 20,000 x g (14,000 rpm) to dry the DNeasy membrane. Discard flow-through and collection tube. It is important to dry the membrane of the DNeasy Mini spin column, since residual
   may interfere with subsequent reactions. This centrifugation step ensures that no
   ethanol will be carried over during the following elution. Following the centrifugation step, remove the DNeasy Mini spin column carefully so that column does not come into contact with the flow-through, since this will result in ethanol. If carryover of ethanol occurs, empty the collection tube, then reuse it in centrifugation for 1 min at 20,000 x g (14,000 rpm).
   
10. 
    Place the DNeasy Mini spin column in a clean 1.5 ml eppendorf tube (not provided), and pipet 100 μl water directly onto the DNeasy membrane. Incubate at room temperature for 1 min, and then centrifuge for 1 min at ≥6000 x g (8000 rpm) to elute. This is your DNA sample!
    

B. Encode your information into DNA

C. Design a Plasmid with Benchling - put your name in it!

• cut / add a single base
• single-based mutation
• or cut. insert a big chunk

• 
  mpubMed
  

• 
  Full text link
  

• 
  Supplementatary materials
  

• 
  TCACTACTCTGACCTATTAAGGT GTTCAA (PEgRNA_GFP_TA Ain_R)
  

• maybe try three different primers

1. Puc19 - empty container : to hold the piece of DNA. / grow it forever.
2. pPegRNA - has something. promoter -> guide RNA scaffold —> put into bacteria it will produce RNA

• For PCR amplification of desired PEgRNA functional cassettes. Sequences in lower case are overhangs for Gibson assembly.

• For PCR amplification of plasmid

• backbone for Gibson assembly of PEgRNA.

• based on PEgRNA_GFP_33i n_R, edited for embedding my name into the DNA
• order both PAGE / non-PAGE options

Order from IDT

• Do the other half of the lab - CRISPR
  • Transformation and Plating (Miniprep, Gibson Assembly, Transform)
  • Culture
• Sequence -

• Genomic DNA extraction kit (for your saliva).
• DNA from Twist to encode the information you want.
  • IMPORTANT: the DNA information needs to have recognition sites for all of the restriction enzymes you’ll use (these are put at the beginning and end of the DNA sequence)
• Restriction enzymes (BsaI and PaqCI are common ones that are used in 2-enzyme systems). The following are required in addition to the enzymes, usually sold in a kit:
  • PaqCI activator
  • T4 ligase
  • T4 ligase buffer